ID: 1031059535

View in Genome Browser
Species Human (GRCh38)
Location 7:117034968-117034990
Sequence GAGGGTAGCAATGCTGTTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031059535_1031059539 14 Left 1031059535 7:117034968-117034990 CCGGAAACAGCATTGCTACCCTC 0: 1
1: 0
2: 1
3: 12
4: 114
Right 1031059539 7:117035005-117035027 AGAATGAAAAACTTTTACTGTGG 0: 1
1: 0
2: 2
3: 39
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031059535 Original CRISPR GAGGGTAGCAATGCTGTTTC CGG (reversed) Intronic
900337360 1:2171008-2171030 GTGGTTAGCAATTCAGTTTCTGG - Intronic
902361764 1:15945857-15945879 GAGGGTAGCAATCCAGCCTCCGG - Intronic
907780169 1:57559557-57559579 GAGGGTCACAATGATGTTTTGGG - Intronic
909818052 1:80021766-80021788 TAGGGGAGCAATGCTGCTTTAGG + Intergenic
910461181 1:87449446-87449468 GAGGAAAGCAGTGCTGTTTTAGG + Intergenic
913412088 1:118563429-118563451 GAGGGTATCAATGGTGAGTCAGG + Intergenic
914318412 1:146535776-146535798 GAGGAAAGCAATGCTGTTGTAGG + Intergenic
914495948 1:148197581-148197603 GAGGAAAGCAATGCTGTTGTAGG - Intergenic
917247869 1:173024140-173024162 GAGGGGAACAGTGCTGTATCAGG + Intergenic
921279282 1:213549780-213549802 GAGGATAGCAATACTATTTCTGG + Intergenic
1062961676 10:1577170-1577192 GAGGGTATCACTGCAGCTTCTGG - Intronic
1062961689 10:1577249-1577271 GAGGGTATTACTGCAGTTTCCGG - Intronic
1062961700 10:1577327-1577349 GAGGGTATCACTGCAGCTTCTGG - Intronic
1062961712 10:1577405-1577427 GAGGGTATCACTGCAGCTTCTGG - Intronic
1065892604 10:30133970-30133992 GAGGATAGCACTGCTGAGTCTGG - Intergenic
1066282200 10:33928288-33928310 GCAGGCAGCAATGCAGTTTCAGG + Intergenic
1069658251 10:70106193-70106215 GAGGGTGGCAGTGCTGCTGCTGG - Intronic
1077840767 11:5972427-5972449 GAGGGGAGCAATGCTGTGTTGGG - Intergenic
1078608531 11:12798855-12798877 GAGGGAAGCAGTGCTGTTCTAGG + Intronic
1080555474 11:33412502-33412524 GAGGCAAGAAATGGTGTTTCTGG + Intergenic
1084865050 11:72048886-72048908 AAGGGAAGGACTGCTGTTTCAGG + Intronic
1087389318 11:97514050-97514072 CAGAGTAGGAATGCTCTTTCAGG - Intergenic
1089156750 11:116408728-116408750 GGGGGGAGGAAGGCTGTTTCTGG - Intergenic
1089918514 11:122183976-122183998 TAGGGTAGTAATGCTGCTTGGGG - Intergenic
1092177566 12:6421099-6421121 GAGAGTAGCAATTCTGTTTGAGG + Intergenic
1092657097 12:10697548-10697570 GATGGTAGCTATTCTATTTCTGG - Intergenic
1093032034 12:14297247-14297269 GAGGATCGCAATGATGTTTTGGG + Intergenic
1098385517 12:69914724-69914746 GGGGGTAGCATTCCTGTTCCAGG + Intronic
1102532600 12:113557809-113557831 GAGGGCAGCTGTGGTGTTTCAGG - Intergenic
1105444186 13:20438347-20438369 GAGGGGAGCAATGATGTCACAGG - Intronic
1107778003 13:43867335-43867357 GAATGTACCAATGCTATTTCAGG + Intronic
1116007954 14:39316830-39316852 GACGGTAACCAGGCTGTTTCTGG + Intronic
1117406093 14:55405660-55405682 CTGGGTAGCAGTGCTATTTCTGG + Intronic
1120562782 14:86017509-86017531 GAGGGTCACAATGATGTTTCAGG + Intergenic
1121338482 14:93091391-93091413 GAGGGGAGCAAGACTGGTTCTGG - Intronic
1122909857 14:104822244-104822266 GAGGGTGGGAATGCTGCCTCAGG - Intergenic
1124786575 15:32687004-32687026 GAGGGCAGCACTGAAGTTTCAGG + Intronic
1125838372 15:42774196-42774218 TTGGGGAACAATGCTGTTTCTGG + Intronic
1128333398 15:66770880-66770902 GAGGGCAGCACCACTGTTTCTGG + Intronic
1133118357 16:3590975-3590997 GAGGGTGGCAGTCCGGTTTCTGG - Exonic
1138193684 16:55036565-55036587 GAGGGCAGCAAGGCAGTTCCCGG - Intergenic
1138304217 16:55959379-55959401 CAGGGGAGCAATACTGTATCAGG - Intergenic
1138789099 16:59881392-59881414 GAGGGTAGCTGTGTTCTTTCAGG - Intergenic
1140815305 16:78615716-78615738 GAAGGAAGAAATGCTGTTTTAGG + Intronic
1143172140 17:4936499-4936521 GAGTGTAGCAATAGTGTTGCAGG - Intergenic
1146239496 17:31205016-31205038 GAGGGAAGAAATGCTTTTTTGGG - Intronic
1147304418 17:39553447-39553469 TGGGGTAAGAATGCTGTTTCAGG - Intronic
1155379969 18:25209615-25209637 GAGGGTAGAAATCCTGATTTTGG + Intronic
1157930119 18:51812408-51812430 TAGGTAAGCAATGCTGTCTCTGG - Intergenic
1160342965 18:78105412-78105434 GAGGGGCGGAATGCTGGTTCCGG + Intergenic
1160847379 19:1172568-1172590 GAGGGGTGCTGTGCTGTTTCGGG - Intronic
1162895751 19:13764023-13764045 GATGGATGCAAGGCTGTTTCTGG - Intergenic
1164457351 19:28419856-28419878 AAGGGTAGCAGTGCTTGTTCTGG + Intergenic
925265515 2:2563841-2563863 GGGGGCAGGAACGCTGTTTCTGG + Intergenic
927846485 2:26475014-26475036 GAGGATGGCAAGGCTGTTACTGG + Intronic
930000535 2:46858670-46858692 GAGGGTGGCACTGGTGTTTGTGG - Intronic
931269629 2:60689935-60689957 GAGGGGAGGAATGCTGTGTGAGG - Intergenic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
932393748 2:71423169-71423191 GATGGTAACAATGCTGTTTTAGG - Exonic
933822652 2:86128312-86128334 GAGGGTAGCAATCTTGTTTGTGG + Intronic
933832590 2:86222965-86222987 GTGGATAGCAATACTCTTTCAGG - Intronic
938806011 2:134807859-134807881 GAGGGAATCAATGCTGAGTCTGG - Intergenic
940253685 2:151707224-151707246 TAGGGTGTCAATTCTGTTTCTGG + Intronic
940296020 2:152125235-152125257 GAGGGTAGGAAAGATTTTTCTGG - Intronic
940976130 2:159946639-159946661 AAGGGTTGCAATGTTGTTTTTGG + Intronic
943170723 2:184395285-184395307 GAGGTAAGTTATGCTGTTTCAGG + Intergenic
943859491 2:192842696-192842718 GATGGAAGCAATGCTCTTTCTGG - Intergenic
946153692 2:217793300-217793322 GAGGGAAGAAAGGGTGTTTCAGG - Intergenic
946248315 2:218399364-218399386 GAGGTTTGCACAGCTGTTTCGGG + Intronic
1171305210 20:24099378-24099400 GTTGGTAGAAATGCTGTTACTGG - Intergenic
1175760930 20:61561921-61561943 GATGGCAGTAATGCTGTGTCTGG + Intronic
1176011273 20:62897591-62897613 GAACGCAGCAATGCTGTTACAGG + Intronic
1176120316 20:63451644-63451666 GAGGGTGGCCATGCTGTTCCAGG + Intronic
1177799666 21:25815883-25815905 AAGTGTAGCAATGGAGTTTCTGG - Intergenic
1178183570 21:30193028-30193050 GAGGGTAGCACCGATGTTTTTGG - Intergenic
949740758 3:7230943-7230965 GTGAGTATGAATGCTGTTTCTGG - Intronic
949901918 3:8822227-8822249 GAGGGAAGAAATGCTCTTTATGG + Intronic
951541067 3:23782404-23782426 TAAGGTAGCAAAGCTGTTTTGGG + Intergenic
952973483 3:38672358-38672380 GGTGGGAGCAATGCTCTTTCCGG + Intergenic
953036560 3:39216733-39216755 GAGGGGAGAAATGATGATTCAGG - Intergenic
955615621 3:60803775-60803797 GAGGGGAGCAATGCGATTTTTGG + Intronic
956508969 3:69974406-69974428 GAGGAGAGAAATGCTCTTTCCGG - Intergenic
959622793 3:108416539-108416561 AAGGGCAGCAAGGCTCTTTCAGG - Intronic
960106316 3:113801533-113801555 GAACCTAGCAATTCTGTTTCTGG + Intronic
962958348 3:140286867-140286889 GAGGTAAGCGATGATGTTTCAGG + Intronic
967352383 3:188527883-188527905 GAGGATAGCAACAGTGTTTCTGG + Intronic
967699706 3:192577230-192577252 AATGGTAGCCATGCTCTTTCTGG + Intronic
968038425 3:195568269-195568291 AAAGGTAACAATCCTGTTTCTGG - Intergenic
969340317 4:6536199-6536221 GAAGGAAACATTGCTGTTTCAGG + Intronic
976776979 4:88718080-88718102 CAGGGCAGCAGTGTTGTTTCAGG - Intergenic
984003732 4:174283574-174283596 GAGGGTCGTAGTGCTGTTTCTGG - Exonic
992123374 5:73616756-73616778 GAGGGGAGAAAGGCTGATTCTGG + Intergenic
994215405 5:97131935-97131957 GAGGGTAGAAATGTGGTTGCTGG + Intronic
998020692 5:138767454-138767476 GAGGGCAGGGAGGCTGTTTCAGG - Intronic
999269566 5:150288910-150288932 GCGGGGAGCACCGCTGTTTCAGG - Intronic
999493752 5:152076644-152076666 GTGGGTATCACTTCTGTTTCAGG + Intergenic
1010573080 6:77501720-77501742 GAGAATAGGAATGCTGCTTCTGG - Intergenic
1016488367 6:144568414-144568436 AAGGGAAGGAATGCTGTTACAGG - Intronic
1019698414 7:2460601-2460623 GAGGGCAGCCCAGCTGTTTCTGG + Intergenic
1022214159 7:28241560-28241582 GAGTTTAGCAATGCTGTTTCAGG + Intergenic
1024731000 7:52253742-52253764 AAAGGTAGCAAAGGTGTTTCTGG + Intergenic
1025533172 7:61915647-61915669 CAGGTTAGAAATGCTGTTTTTGG + Intergenic
1026167770 7:67925515-67925537 GAGGGAGGCAATTTTGTTTCTGG + Intergenic
1029038506 7:97548662-97548684 GAGGCTAGCCATGCTGATTGTGG - Intergenic
1030872568 7:114775076-114775098 GAGGGTAGAGCTGGTGTTTCTGG + Intergenic
1031059535 7:117034968-117034990 GAGGGTAGCAATGCTGTTTCCGG - Intronic
1031465284 7:122102445-122102467 TAAGTTAGCATTGCTGTTTCTGG + Intronic
1034440110 7:151081958-151081980 GAGGGTGGGAGTGCTGTTCCGGG - Intronic
1035635363 8:1139971-1139993 GAGGGCAGCAAGGCTGGCTCAGG - Intergenic
1035914058 8:3599544-3599566 GTGGTTAGCAATGCTGTGTGGGG - Intronic
1040042694 8:42932408-42932430 GAAGATAGTGATGCTGTTTCAGG + Intronic
1041256764 8:55985442-55985464 GAGGATAGCAAATCTGTTTCAGG + Intronic
1045166456 8:99611637-99611659 GAGTGTAAAAATGCTGTTTTAGG - Intronic
1045477960 8:102569273-102569295 GAGGGAAACAATGGTGTTACTGG + Intergenic
1048553216 8:135453311-135453333 CTGGGTAGCATTGCTGTTCCGGG + Intergenic
1050191299 9:3029388-3029410 GAGGGAAGGAAGCCTGTTTCTGG + Intergenic
1051169255 9:14302512-14302534 CAGGATAGCAATGAGGTTTCTGG + Intronic
1052881319 9:33602472-33602494 GAGGGTGGAAAGGCTGTATCTGG - Intergenic
1052936248 9:34095490-34095512 GAGGGTAGCAGTGCTGAGGCAGG - Intronic
1053494999 9:38543370-38543392 GAGGGTGGAAAGGCTGTATCTGG + Intronic
1062495758 9:136830843-136830865 TATGGTAGCAATGCTCTGTCTGG + Intronic
1186526455 X:10253536-10253558 GAGTGTAGCAGTGCTGTTGCTGG - Intergenic
1187066658 X:15846568-15846590 GAGGGTAGCAGAGGAGTTTCAGG - Intronic
1189870736 X:45380771-45380793 GAGGGAAGCAAGGCCTTTTCTGG - Intergenic
1190538200 X:51449895-51449917 GAGGGCAACAATGATGTTTCAGG - Intergenic
1190593849 X:52033197-52033219 TAGGGCAGCAATGTTGTTTTGGG - Intergenic
1198207193 X:134477974-134477996 CAGGGTAGAAATGCTACTTCAGG - Intronic
1200600633 Y:5200776-5200798 CAAGGCAGCCATGCTGTTTCAGG - Intronic