ID: 1031063233

View in Genome Browser
Species Human (GRCh38)
Location 7:117075602-117075624
Sequence CTTCCAGGCCTGTCTGTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031063230_1031063233 -3 Left 1031063230 7:117075582-117075604 CCACATTGTACTTTTTCCTGCTT No data
Right 1031063233 7:117075602-117075624 CTTCCAGGCCTGTCTGTGTGAGG No data
1031063229_1031063233 0 Left 1031063229 7:117075579-117075601 CCTCCACATTGTACTTTTTCCTG 0: 1
1: 0
2: 0
3: 32
4: 282
Right 1031063233 7:117075602-117075624 CTTCCAGGCCTGTCTGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031063233 Original CRISPR CTTCCAGGCCTGTCTGTGTG AGG Intronic