ID: 1031065185

View in Genome Browser
Species Human (GRCh38)
Location 7:117097149-117097171
Sequence GTTGCTAGGCAGTCAACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031065183_1031065185 -5 Left 1031065183 7:117097131-117097153 CCATTGCTTTGTGCTTTTGTTGC 0: 1
1: 0
2: 0
3: 65
4: 536
Right 1031065185 7:117097149-117097171 GTTGCTAGGCAGTCAACAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 127
1031065182_1031065185 0 Left 1031065182 7:117097126-117097148 CCTCTCCATTGCTTTGTGCTTTT 0: 1
1: 0
2: 3
3: 51
4: 555
Right 1031065185 7:117097149-117097171 GTTGCTAGGCAGTCAACAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031065185 Original CRISPR GTTGCTAGGCAGTCAACAGC AGG Intronic
903814882 1:26057638-26057660 GTTGCTTGGCAGTCTGCAGGGGG + Exonic
903963758 1:27073187-27073209 GTAACCAGGCAGTCACCAGCTGG - Intergenic
908441252 1:64156922-64156944 GCTGCTAGTAAGTCAAAAGCTGG - Intronic
909100571 1:71343193-71343215 GTAGCTAGTCAGGCAAGAGCAGG - Intergenic
909537284 1:76751480-76751502 GTGGCTAGGCATTCATGAGCAGG + Intergenic
910064885 1:83141164-83141186 GTTGCTAGGCTGCACACAGCAGG - Intergenic
912940178 1:114037763-114037785 GTAGCTAGGCAGACATGAGCAGG - Intergenic
913520059 1:119636854-119636876 GTGGCTAGGAAGTGAAGAGCAGG - Intronic
913668412 1:121071458-121071480 GTTCCTAGGCTGTACACAGCAGG + Intergenic
914020155 1:143858901-143858923 GTTCCTAGGCTGTACACAGCAGG + Intergenic
914658656 1:149766813-149766835 GTTCCTAGGCTGTACACAGCAGG + Intergenic
915422471 1:155795004-155795026 GCTGCAAAGCAGTCAAGAGCAGG + Intronic
916171513 1:162004610-162004632 GGTGCCAGGCAGGCAGCAGCTGG - Intronic
920885598 1:209924906-209924928 ATTGCTAGGCAGTCTATAGAGGG + Intergenic
1067927343 10:50523118-50523140 GTTTTCAGGCAGTGAACAGCAGG - Intronic
1074013554 10:109508966-109508988 TTTCCTGGGAAGTCAACAGCGGG - Intergenic
1085652056 11:78277324-78277346 GTAGCTAGGCAGACATGAGCAGG + Intronic
1087745809 11:101945607-101945629 TGTGGTAGGCAGTCAAGAGCTGG + Intronic
1090528376 11:127562288-127562310 GTTGGTAGGCAGTCACCAATCGG + Intergenic
1090570542 11:128039869-128039891 GTTGCAAGGCAGTCATCGCCAGG + Intergenic
1091631371 12:2163475-2163497 GTTCCTAGGCTATCAATAGCAGG - Intronic
1092756904 12:11772194-11772216 GAAGCTAGGCAGCCAACAGAGGG + Intronic
1095595067 12:43949734-43949756 GTAGCTAGGCAGACATGAGCAGG - Intronic
1101389626 12:104288799-104288821 CTTGCAAGGGAGTCAACAGAGGG + Intronic
1102603702 12:114052812-114052834 GCTGCTGTGCAGTAAACAGCAGG - Intergenic
1103842732 12:123878458-123878480 GTTTCAAGGCACTCAAAAGCAGG - Intronic
1104172126 12:126292144-126292166 GTTGCTAGGCTGCACACAGCAGG + Intergenic
1104432520 12:128728066-128728088 GTAGCTAGGCAGACATGAGCGGG - Intergenic
1107462056 13:40613759-40613781 GCTGCTAGGCAGTCAGCTGGAGG - Intronic
1107762812 13:43699004-43699026 GTTATGAGGCAGTCATCAGCTGG - Intronic
1108585035 13:51863623-51863645 GTGGCTAGGCTGTGGACAGCTGG - Intronic
1111430378 13:88142308-88142330 CTTCCTAGGCAGCTAACAGCAGG - Intergenic
1111521758 13:89413797-89413819 GTAGCTAGGCAGACATGAGCAGG - Intergenic
1113257453 13:108522672-108522694 ATTGCCAGGCAGTCACCAGAAGG - Intergenic
1113947645 13:114053150-114053172 GCGGCTGGGCAGTCAGCAGCAGG - Intronic
1117099791 14:52334481-52334503 GTAGCTAGGCAGACATGAGCTGG - Intergenic
1119872063 14:78026534-78026556 GCTGCTAGGCAGACCAGAGCTGG + Intergenic
1126381363 15:48050865-48050887 GCTGCATGGCAGTCAAGAGCAGG - Intergenic
1126469345 15:48990959-48990981 TTTGCTAGTCAGTCACCACCTGG - Exonic
1128385105 15:67142067-67142089 GTAGCGAGGCAGTGAAGAGCTGG + Intronic
1128595223 15:68939703-68939725 GTTGCTAGGCAGCCAAGAACAGG + Intronic
1128730921 15:70020566-70020588 GCTCCTCAGCAGTCAACAGCAGG - Intergenic
1133240111 16:4409159-4409181 GTTGGGAGGCAGACAGCAGCAGG - Intronic
1135777636 16:25270917-25270939 GCTGCCAGGCACACAACAGCTGG + Intergenic
1138940231 16:61781507-61781529 GATGCTAGGGAGTCTAAAGCAGG + Intronic
1139605627 16:68016162-68016184 GGTGCTAAGCAATCAACAGCAGG + Intronic
1139968448 16:70758656-70758678 GCTGCCAGGCAGCCAACAACTGG + Intronic
1143477085 17:7208922-7208944 GTTTCCAAGCAGTCAACAGAGGG + Intronic
1145841224 17:27996551-27996573 GTGGCTTGGCAGACAGCAGCTGG - Intergenic
1146685241 17:34837079-34837101 GATGCTGGGCAACCAACAGCTGG + Intergenic
1148522747 17:48297086-48297108 GTTTTTAGTCAGTCAACAACAGG - Intronic
1149258042 17:54849397-54849419 GTAGCTAGGCAGACATGAGCAGG + Intergenic
1153538837 18:6133615-6133637 GTAGCTAGGCAGACATGAGCAGG + Intronic
1153964494 18:10167487-10167509 GTTGCAGGGCAGCCAACAGCTGG + Intergenic
1155368975 18:25078200-25078222 GTTCCGAGGCAGGCAACAGGAGG - Intronic
1156496678 18:37530467-37530489 CTTGCTGGGCAGGCAGCAGCTGG - Intronic
1158094571 18:53756159-53756181 GTAGCTAGGCAGACATGAGCAGG + Intergenic
1158588052 18:58757804-58757826 CATTCCAGGCAGTCAACAGCAGG - Intergenic
1160551832 18:79698371-79698393 GTTGCTAGGATGTCAAGGGCAGG + Intronic
1166498087 19:43319779-43319801 GTAGCTAGTCAGACATCAGCAGG + Intergenic
925985841 2:9214019-9214041 GTTTCTATGCAGACTACAGCAGG + Intronic
926637272 2:15195530-15195552 GTAGCTAGGCAGACATGAGCAGG + Intronic
932853307 2:75208899-75208921 ATTTCTAGGCAGTCAGAAGCAGG + Intergenic
937366596 2:121266523-121266545 GTTTAGAGGCAGACAACAGCAGG + Intronic
939191289 2:138919451-138919473 GTTCCTAAGCAATCCACAGCTGG - Intergenic
940115914 2:150208228-150208250 GCTGCTTGGCACTCAGCAGCTGG + Intergenic
940566288 2:155364862-155364884 GTAGCTAGGCAGACATGAGCAGG - Intergenic
940860726 2:158768107-158768129 GTGACTATGCAGTCAAAAGCTGG + Intergenic
941717838 2:168782431-168782453 GTAGCTAGTCAGTCATGAGCAGG + Intergenic
941929819 2:170928787-170928809 GATGCTAGGCAGCCCACAGGAGG + Exonic
942110094 2:172673597-172673619 GTAGCTAGTCAGTCATGAGCAGG - Intergenic
943633502 2:190280343-190280365 GTAGCTAGGCAGACATGAGCAGG + Intronic
1169203729 20:3728848-3728870 GTTGCTGCTCTGTCAACAGCTGG - Intergenic
1173412732 20:42828602-42828624 GTTCCTAGGCTGCCCACAGCAGG - Intronic
1176802107 21:13440833-13440855 GTTTCTATGCAGTGAGCAGCAGG - Intergenic
952302631 3:32117386-32117408 GTTTCTAGGCCCTCTACAGCTGG - Intronic
953790004 3:45940159-45940181 GTAGCTAGGCAGACATGAGCAGG + Intronic
953798015 3:46000361-46000383 GTAGCTAGGCAGACATGAGCAGG + Intergenic
954634785 3:52065551-52065573 GTTCCCAGGTAGGCAACAGCAGG + Intergenic
957159850 3:76596637-76596659 GCTACTAGGCCATCAACAGCAGG + Intronic
957315903 3:78576000-78576022 GTAGCTAGGCAGACATGAGCAGG - Intergenic
957671330 3:83306143-83306165 ATTGCTAGGCAGACAATAGGCGG + Intergenic
958929891 3:100197703-100197725 GTAGTTAGGCAGGCAAGAGCAGG - Intergenic
959968612 3:112383126-112383148 ATAGTTAGGCAGCCAACAGCAGG + Intergenic
961480922 3:127180213-127180235 GTAGCTAGGCAGACATGAGCAGG + Intergenic
969653408 4:8481553-8481575 GTTGGTAGGCAGGCAGCAGCGGG - Intronic
969947482 4:10799324-10799346 GTAGCTAGTCAGTCATGAGCAGG - Intergenic
970133019 4:12891842-12891864 ATTGCTAGGCAGTCACCAGAGGG + Intergenic
971421888 4:26481422-26481444 GTTTCTAGGCAGTTCAAAGCAGG - Exonic
971764760 4:30815911-30815933 GTAGCTAGGCAGACATTAGCAGG - Intronic
974156982 4:58086085-58086107 GTAGCTAGTCAGTCATGAGCAGG - Intergenic
974972249 4:68844814-68844836 GTTGCTAGGCTGCACACAGCAGG - Intergenic
975033481 4:69653387-69653409 GTTGCTAGGGAACCAACAGAAGG - Intergenic
979038682 4:115759092-115759114 GTAGCTAGGCAGACATAAGCTGG + Intergenic
986606265 5:9526467-9526489 TTTACCAGGCAGTGAACAGCTGG - Intronic
986923349 5:12716236-12716258 GTTTCTGTGCAGTGAACAGCAGG - Intergenic
987306042 5:16638826-16638848 AATGCTAGACAGTGAACAGCAGG + Intergenic
989189408 5:38655403-38655425 GGTGATAGGCAGTGAACAGAAGG + Intergenic
990594125 5:57296047-57296069 GTAGCTAGGCAGACATGAGCAGG + Intergenic
995191346 5:109322051-109322073 GTAGCTAGGCAGGCATGAGCAGG + Intergenic
998528054 5:142860505-142860527 GTTTCTGGGCAGTCAGCACCAGG + Intronic
999518494 5:152324881-152324903 GTAGCTAGGCAGACAGGAGCAGG - Intergenic
1002475734 5:179464690-179464712 GTTGGCAGGCCATCAACAGCGGG - Intergenic
1004200638 6:13544566-13544588 GTTGTTAGGTAGACATCAGCAGG + Intergenic
1005158242 6:22833314-22833336 GTAGCTAGGCAGACATGAGCAGG + Intergenic
1007486575 6:42184700-42184722 GGTGCCAGGAAGTCAACACCAGG + Exonic
1010184732 6:73130287-73130309 GTTGCCTGGCAGAGAACAGCCGG + Intronic
1011478694 6:87773063-87773085 GTAGCTAGGCAGACAGGAGCAGG + Intergenic
1012563472 6:100616839-100616861 GTTTCTTGCCAGTTAACAGCAGG - Intronic
1013431116 6:110055486-110055508 GTTGGAAGGCAGCCAACACCTGG - Intergenic
1017426843 6:154330913-154330935 GTAGCTAGGCAGACATGAGCAGG + Intronic
1017751034 6:157490833-157490855 ATTGATAGGCATTCAACAACTGG - Intronic
1018522988 6:164673185-164673207 GTTGGTAGACAGGCAACAGGTGG + Intergenic
1018824724 6:167400480-167400502 GTTTCTAGGAAGGCAACAACTGG - Intergenic
1020658626 7:10956264-10956286 GTTGCACGGCAGCCAGCAGCTGG - Intergenic
1023315585 7:38932734-38932756 GCTGCTAGGCAGCCAACAGGGGG + Intergenic
1026274442 7:68864405-68864427 GTAGCTAGGCAGACATAAGCAGG + Intergenic
1027279225 7:76593585-76593607 GTTGCTAGGCTGCACACAGCGGG + Intergenic
1028077883 7:86536908-86536930 GTAGCTAGGCAGACATGAGCAGG - Intergenic
1029273981 7:99393415-99393437 GTGGCCAGGCAGTGACCAGCGGG + Intronic
1031065185 7:117097149-117097171 GTTGCTAGGCAGTCAACAGCAGG + Intronic
1034425504 7:151011925-151011947 GTTCCTAGGCTGCCATCAGCTGG + Intronic
1039705041 8:39997956-39997978 TTTGCTAGCCAGTCACCAGCCGG - Intronic
1040673057 8:49715761-49715783 GTAGCTAGTCAGTCATGAGCAGG + Intergenic
1041351014 8:56947617-56947639 GTAGCTAGACAGGCATCAGCAGG + Intergenic
1047073357 8:121372676-121372698 CTTGCTAATCAGTCAACAACTGG - Intergenic
1050500275 9:6290785-6290807 GTTGCTATACAGTCATCAGCTGG - Intergenic
1050849276 9:10263889-10263911 GTCCCTAGGCAGCAAACAGCAGG - Intronic
1052160663 9:25255070-25255092 GTTACTAGGCAGACATGAGCAGG + Intergenic
1055994420 9:82141804-82141826 GTTTCTTGACACTCAACAGCAGG + Intergenic
1056912284 9:90713147-90713169 GTAGCTAGGCATTAAACTGCTGG - Intergenic
1060212667 9:121720076-121720098 GATGCCAGGCAGCCTACAGCTGG + Intronic
1185565742 X:1093779-1093801 GGTGCAAGGCAGACAGCAGCCGG + Intergenic
1187036509 X:15545805-15545827 GTAGCTAGGCAGACATGAGCAGG - Intronic
1193756683 X:85418063-85418085 GTAGCCAGGCAGTGAACAGCAGG - Intergenic
1196556659 X:117093437-117093459 GTTAATAGCCAGTTAACAGCTGG + Intergenic
1199155779 X:144547428-144547450 GTTGCGATGTAGTCAACAGGTGG + Intergenic