ID: 1031068392

View in Genome Browser
Species Human (GRCh38)
Location 7:117134020-117134042
Sequence CAGGGTAATCAAAGAGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 1, 2: 2, 3: 31, 4: 373}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031068392 Original CRISPR CAGGGTAATCAAAGAGGGGA AGG (reversed) Intronic
900587781 1:3441530-3441552 CAGGCTGAACAAAGATGGGAAGG - Intergenic
900754644 1:4425128-4425150 CAGTGTAATCAATGATGGCAGGG + Intergenic
901959637 1:12814997-12815019 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
902439360 1:16419373-16419395 TAGGGTAATGAAAGAGGGAGTGG + Intronic
903748198 1:25602642-25602664 CAGGGAAGGCAAAGAAGGGAAGG + Intergenic
904031029 1:27533500-27533522 CAGGGTAGACAGAAAGGGGAGGG + Intergenic
905697138 1:39983064-39983086 CACTGTAATCAAGTAGGGGAGGG - Intergenic
905841202 1:41180362-41180384 CAGGGCAATCAGACAGGAGAAGG + Intronic
905899873 1:41574430-41574452 CAGGGTAGTCAATGATGGGAAGG - Intronic
906904694 1:49877152-49877174 CAGGGCAATCACACAGGAGACGG - Intronic
906925460 1:50110960-50110982 CAGTGTAAAAAAAAAGGGGAGGG + Intronic
909676629 1:78245543-78245565 CAGGGCAATCAGACAGGAGAAGG - Intergenic
909723720 1:78809165-78809187 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
911783006 1:101907554-101907576 TAGGGATAGCAAAGAGGGGACGG + Intronic
913506733 1:119523798-119523820 CAGGGCAATTAAACAGGAGAAGG + Intergenic
913532934 1:119745747-119745769 CTGGGTCATGAAAGAGGGCATGG + Intergenic
914996721 1:152549784-152549806 CAGGGTAATCAGGCAGGAGAAGG - Intronic
915003565 1:152615597-152615619 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
915642936 1:157243754-157243776 CAGGGCAATCAAGCAGGAGAAGG - Intergenic
915644414 1:157258049-157258071 CAGGGCAATCAAGCAGGAGAAGG + Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
915732171 1:158061416-158061438 CAGGGAGATCAAAAAGGGAAAGG + Intronic
916791472 1:168129131-168129153 CAGGGTAAGCAGAGAGGGAATGG + Intronic
917182158 1:172310578-172310600 CAGGCTCTTCAAAGAAGGGAGGG + Intronic
917263904 1:173199081-173199103 CTGGATAACCAAAGAGGGTACGG - Intronic
917591527 1:176481055-176481077 CAGGATTGTGAAAGAGGGGAGGG + Intronic
917984702 1:180304254-180304276 CAGGGTAATCAGGCAGGAGAAGG + Intronic
920382960 1:205546321-205546343 CAGGGTACCCAAAGAGGGTCAGG + Intergenic
921928105 1:220729958-220729980 CAGGCCAATCAAAGATGGGCAGG + Intergenic
922387642 1:225103884-225103906 CAGGGCAATCAGGCAGGGGAAGG - Intronic
922888117 1:229036242-229036264 CAGGGGAATCAGAGGAGGGAAGG - Intergenic
923109505 1:230879737-230879759 CAGGGTGATTGAGGAGGGGAAGG - Intergenic
1063941322 10:11132914-11132936 CAGGATAATCTAAGAGGTGATGG + Intronic
1065464728 10:26007379-26007401 CAGGGCAATCAGGGAGGAGAAGG + Intronic
1071808801 10:89155324-89155346 CTGGGTACCAAAAGAGGGGAAGG + Intergenic
1072311607 10:94161649-94161671 CAGGGTAATCAGACAGGAGAAGG - Intronic
1072730687 10:97844261-97844283 CAGGGCAAACAGAGAGGGGATGG - Intergenic
1073020874 10:100442679-100442701 TATGGTAAGCAAAGAGGGGAGGG - Intergenic
1074554903 10:114479464-114479486 CAGAGTTCTCAAGGAGGGGAAGG - Intronic
1077946806 11:6908712-6908734 CAGGGAAATCAAGCAGGAGAAGG + Intergenic
1079160549 11:17988769-17988791 AAGGGTAACAAAAGAGGTGAGGG + Intronic
1080806687 11:35660665-35660687 CAGGGTATTTGATGAGGGGAGGG - Intergenic
1081075188 11:38664087-38664109 CAGTGAAATCAAAGAAGAGAAGG - Intergenic
1081735875 11:45403789-45403811 CTGGGTAATCTAGGAGGGGATGG - Intergenic
1082112079 11:48288167-48288189 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1082140193 11:48599949-48599971 CAGGGCAATCAGACAGGAGAAGG + Intergenic
1082247894 11:49946072-49946094 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1082263554 11:50096392-50096414 CAGGGTAAGGTAAGTGGGGAGGG - Intergenic
1082647958 11:55751520-55751542 CAGGGCAATCAAGCAGGAGAAGG + Intergenic
1082791574 11:57349602-57349624 CAGGGAAAGGAAAGAGGGGAGGG + Intronic
1084277018 11:68057793-68057815 CAAGGTAATTTAAGAGGGAAAGG - Intronic
1084472424 11:69370865-69370887 CAGGGTATTTATAGAGGGAATGG - Intergenic
1085786984 11:79461450-79461472 AAATGTAATCAGAGAGGGGAGGG - Intergenic
1085919714 11:80938178-80938200 CAGGGGAATCAGTGAGAGGAGGG - Intergenic
1087224463 11:95582445-95582467 CAGGGAAAGCAAAGAGCTGAAGG - Intergenic
1087867642 11:103251683-103251705 CAGGGGAATGAAGGAGGGGATGG - Intronic
1088688400 11:112304368-112304390 CAGGAAAAACAAAGAAGGGAGGG - Intergenic
1091038072 11:132251823-132251845 CTGGCTTGTCAAAGAGGGGAGGG + Intronic
1091193138 11:133710959-133710981 CAGGGAGGTCACAGAGGGGAGGG - Intergenic
1091742941 12:2973005-2973027 CAGGGGATGCCAAGAGGGGAAGG - Intronic
1091797155 12:3304013-3304035 CAGGGAGAGCAAAGAGGGGTTGG - Intergenic
1092772798 12:11913301-11913323 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1093477103 12:19568212-19568234 CAGGGTAATCAGGCAGGAGAAGG + Intronic
1094728119 12:33143758-33143780 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1094877616 12:34669070-34669092 CAGGGCAATTAAGCAGGGGAAGG - Intergenic
1095279183 12:40330095-40330117 GAGAGTAATCAAAGAGGGCGAGG - Intronic
1095349246 12:41189100-41189122 CAGGGTAAGCAAAGGGGGGTGGG + Exonic
1096070721 12:48774121-48774143 CAGGGTAACCAAGGAGGGAAAGG + Intronic
1097963042 12:65551408-65551430 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1098078920 12:66762437-66762459 CAGGAAAATGAAAGAGGGAAAGG - Intronic
1099558767 12:84146859-84146881 CAGGATAATTAATGAGAGGAGGG + Intergenic
1099720318 12:86353937-86353959 CAAGGTAATCAAGAAGAGGATGG + Intronic
1099772294 12:87076713-87076735 CAGGGCAATCAGGGAGGAGAAGG - Intergenic
1100219300 12:92486704-92486726 CACGGAAATCAAAGAAAGGAAGG - Intergenic
1101028689 12:100638816-100638838 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1102983792 12:117262904-117262926 AAGTTTAAGCAAAGAGGGGAAGG - Intronic
1103926606 12:124426867-124426889 CAGGGAAGACACAGAGGGGACGG + Intronic
1104472316 12:129039551-129039573 CAGGGCAATCAAGCAGGAGAAGG - Intergenic
1104739741 12:131163946-131163968 CAAGGAAATAAAAGCGGGGAGGG + Intergenic
1108478025 13:50840671-50840693 GAGGGTCAGCAAAGAGGGGGCGG + Intronic
1115104003 14:29737859-29737881 AAGGGTGATTAAAAAGGGGATGG - Intronic
1116412982 14:44647599-44647621 CAGGGTAGTCATAGGGGAGATGG - Intergenic
1116635507 14:47389727-47389749 CAGGGTGAAAAAAGGGGGGAGGG + Intronic
1116704664 14:48281701-48281723 CAGGGCAATCAAGCAGGAGAAGG - Intergenic
1116716892 14:48439041-48439063 CAGGGCAATCAGACAGGAGATGG - Intergenic
1117740684 14:58816352-58816374 CAGAGCAAGCAAATAGGGGAAGG - Intergenic
1117830324 14:59743715-59743737 CAGGGGAAACAAAGAGGTGAAGG - Intronic
1119162837 14:72467586-72467608 CAGTGGGATCAAAGAGGTGAAGG - Intronic
1123407900 15:20033924-20033946 CAGGGCAATGAAACAGGAGAAGG - Intergenic
1123517226 15:21040578-21040600 CAGGGCAATCAAACAGGAGAAGG - Intergenic
1125359756 15:38852570-38852592 CAGGGCAATCAAGCAGGAGAAGG + Intergenic
1125599450 15:40907307-40907329 CAGGTTAAGGAAAGAGGGCATGG - Intergenic
1128519629 15:68366808-68366830 CAGGGTTTTCAATGAGGGGCAGG - Intronic
1129621613 15:77152482-77152504 CAGGGCAATCAGGGAGGAGAAGG - Intronic
1129636478 15:77323991-77324013 CAGGTTTATCAAAGATCGGATGG - Intronic
1129805778 15:78456023-78456045 CCGAGTAATCTAAGAGAGGAAGG + Intronic
1131654412 15:94440764-94440786 CAGGGCAATCAGAGAGTGGGTGG + Intronic
1133002018 16:2856571-2856593 CAGGGTAAGGAAAGAGGGGGAGG - Intronic
1134587127 16:15421314-15421336 CAGTGGAATCAAAGACAGGATGG - Intronic
1134816278 16:17208284-17208306 CAGGGAACTCAAAGAAGGGATGG - Intronic
1136281172 16:29212322-29212344 CAGGGAACTGAGAGAGGGGAGGG + Intergenic
1138002464 16:53296045-53296067 CAGAGTAAGCAAAGAGGGAGTGG - Intronic
1138076328 16:54046107-54046129 CAGGGCAATCAAGCAGGAGAAGG + Intronic
1138427900 16:56948491-56948513 CAGGTCCAGCAAAGAGGGGAAGG - Intergenic
1139072553 16:63401037-63401059 CAGGGTTAACTAAGAGTGGAAGG + Intergenic
1140042739 16:71419773-71419795 CAGGGTAAACATACAGAGGAAGG + Intergenic
1142085535 16:88178245-88178267 CAGGGAAATGAGAGAGGGGAGGG + Intergenic
1144065691 17:11622215-11622237 CAGGGAAGACAAAGATGGGAAGG + Intronic
1144065844 17:11623383-11623405 CAGGGCAAACAAAGAGGTCAGGG - Intronic
1145730927 17:27185024-27185046 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
1146605689 17:34255712-34255734 CAGGGTAATCAAAGAGAGGGTGG + Intronic
1148605757 17:48927789-48927811 AAGGGTGAGGAAAGAGGGGAGGG - Exonic
1148713015 17:49695565-49695587 CAGGGGGTTCAAAAAGGGGAAGG - Intergenic
1149721392 17:58848267-58848289 CAGGGTAATCAGGCAGGAGAAGG - Intronic
1150896251 17:69213858-69213880 AAAGGTAATAAAATAGGGGAGGG - Intronic
1151645262 17:75426373-75426395 CAGGGTAATTAGTGAGGGAAAGG + Intergenic
1151819618 17:76490509-76490531 CAGGGTACACCAAGAGGGCATGG + Intronic
1152317472 17:79589467-79589489 CAGGGTCTTCTCAGAGGGGATGG - Intergenic
1154332891 18:13444072-13444094 CAGGGTAATCAAATCGTTGATGG - Intronic
1156128570 18:33939060-33939082 CAGGTTTATCAAAGATGAGATGG + Intronic
1157631698 18:49104406-49104428 CAGGGCAATCAGGCAGGGGAAGG - Intronic
1158039961 18:53081118-53081140 CAGAGGAAATAAAGAGGGGAGGG - Intronic
1158057348 18:53297344-53297366 TATGGTGATCAAAGAGGGGATGG + Intronic
1158153714 18:54401725-54401747 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1158176776 18:54666183-54666205 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1158243863 18:55408411-55408433 CAGGGTAATCAGAGATGGATGGG - Intronic
1158250224 18:55479618-55479640 CAGGCTGATCAAAGAGGAAAAGG - Intronic
1158529695 18:58247821-58247843 GATGGTAATGAACGAGGGGAGGG - Intronic
1158792476 18:60798455-60798477 CAGGTTTATCAAAGAGCAGATGG + Intergenic
1159290632 18:66414411-66414433 CAGGCTTATCAAAGATCGGATGG - Intergenic
1160629819 18:80239071-80239093 CAGAGGAGTCTAAGAGGGGAGGG - Intronic
1161195956 19:2986900-2986922 CTGGGTCTTCAAGGAGGGGAGGG + Intronic
1162781105 19:13007431-13007453 CAGGGCAATCAGAAATGGGAGGG - Intronic
1162884997 19:13690407-13690429 CAGGGTAATCAATAAGGGGATGG + Intergenic
1163311108 19:16515043-16515065 GAGGGTAAAAAAAGAGGTGAGGG - Intronic
1164918121 19:32068073-32068095 CAGGGCAATCAAACAGGGCCCGG + Intergenic
1167381031 19:49138202-49138224 CAGGCTGATCCAAGAGGAGAAGG + Exonic
1167430911 19:49453872-49453894 CTGGGTAATCAAAGGGATGAAGG - Intronic
1167637513 19:50663447-50663469 CAGAGTAATGAAAGTGGAGAGGG - Intronic
927239395 2:20907467-20907489 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
928189915 2:29154631-29154653 CAGGGAAATCATAGAGAGGAGGG + Intronic
928795737 2:35016577-35016599 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
932520599 2:72407862-72407884 CAGGGCAATCAGACAGGAGAAGG + Intronic
932649761 2:73542511-73542533 CAGGGCAATCAGGCAGGGGAAGG + Intronic
933326966 2:80850172-80850194 CAAGGTAAACAAGGAGGGGCCGG - Intergenic
933330817 2:80890997-80891019 AAGGGTAATCAAAGGAGGTAAGG - Intergenic
933751296 2:85603442-85603464 GTTGGTAAGCAAAGAGGGGAAGG + Intronic
936945546 2:117927267-117927289 CAGGGCAATCAAGCAGGAGAAGG + Intronic
936996231 2:118416918-118416940 CAGGAGAAACCAAGAGGGGAGGG - Intergenic
937580006 2:123473831-123473853 CAGGACACTCAAAGAGGGGAGGG - Intergenic
937870569 2:126783106-126783128 CTGGGGAGGCAAAGAGGGGAAGG + Intergenic
938079578 2:128362640-128362662 CAGGGAAAGCAGACAGGGGATGG - Intergenic
939544706 2:143538373-143538395 CAGGGTAATCAGGCAGGAGAAGG - Intronic
939573721 2:143870820-143870842 AATGGTAATCCCAGAGGGGAGGG + Intergenic
941217344 2:162729058-162729080 CAAGGTAATGTAATAGGGGAAGG - Intronic
941623603 2:167806322-167806344 CAGGGCAATCAGACAGGAGAAGG - Intergenic
943674074 2:190699313-190699335 CAGGAAAATAAAAGAGGAGATGG + Intergenic
945482817 2:210362953-210362975 CCAGGAAATGAAAGAGGGGATGG - Intergenic
945984738 2:216344567-216344589 CAGGGGAATCAAGGAGGGCAGGG + Intronic
946645737 2:221831865-221831887 AAGAGTAATCAGAGAGGGAAGGG - Intergenic
947290034 2:228562826-228562848 CAGGAAAATCAGAGATGGGAGGG - Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
948025386 2:234772246-234772268 CAGGGTAATCCAGGTGGGAAGGG + Intergenic
948055452 2:235006793-235006815 CTGGGGATTCAAAGAGGGGCTGG + Intronic
948463341 2:238140646-238140668 CAGGGTCAGCCAAGTGGGGATGG - Intronic
948550077 2:238765340-238765362 CAGGGTAATCAGGAAGGGCAAGG - Intergenic
1168958234 20:1849497-1849519 CATGGTAATCAAAAAGAGGTCGG + Intergenic
1169084985 20:2820970-2820992 CAGGGTCGTCAGGGAGGGGAAGG + Intergenic
1169954704 20:11088302-11088324 CAGGTTCATCAAAGATCGGATGG - Intergenic
1170159509 20:13297396-13297418 CAGGGGAATTAGAGAAGGGAGGG - Intronic
1170544546 20:17424405-17424427 CTGAGGAAGCAAAGAGGGGAAGG + Intronic
1171801444 20:29623493-29623515 CAGGGCAATCAGAAAGGAGAAGG + Intergenic
1171819460 20:29820855-29820877 CAGGGAAATCAAGCAGGAGATGG + Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1174090201 20:48040542-48040564 CTGGGAAATCAGAGAGGAGACGG + Intergenic
1174336828 20:49868381-49868403 CAGGGTTTTCAGAGAGGGGCAGG + Intronic
1174826110 20:53770354-53770376 CAGGGTGATTAAGGTGGGGAAGG - Intergenic
1175555778 20:59855226-59855248 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1175851854 20:62097923-62097945 CAGGGAAATGGAAGATGGGAAGG + Intergenic
1176700772 21:10047208-10047230 CAGGGTAATTAGGCAGGGGAAGG + Intergenic
1177130100 21:17245321-17245343 CAGGGTTATCAAAGATCTGATGG - Intergenic
1177306895 21:19330264-19330286 AAGGATAACCAAAGAGAGGAGGG - Intergenic
1177873547 21:26602857-26602879 AAGGGTAGTCAGAGAGGGAAGGG - Intergenic
1180701982 22:17786045-17786067 CAGGGGACACGAAGAGGGGAGGG + Intergenic
1181544302 22:23592343-23592365 CAGAGTAATCAGAGAGGAGGTGG + Intergenic
1182761738 22:32727948-32727970 CAGGTTTATCAAAGATCGGATGG - Intronic
1184108417 22:42381782-42381804 CAAGGTAAGCAGAGAGGTGAGGG - Exonic
951816296 3:26758828-26758850 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
951963485 3:28355000-28355022 CAGGGTAATCAGGCAGGAGAAGG + Intronic
951964360 3:28366137-28366159 CAGGGTAATCAGGCAGGAGAAGG - Intronic
952550149 3:34467594-34467616 CAGGTTTATCAAAGAGCAGATGG + Intergenic
952829133 3:37548921-37548943 TAGGGCAAGAAAAGAGGGGAAGG + Intronic
953146003 3:40275493-40275515 CAGGGCAATCAGACAGGAGAAGG + Intergenic
953266040 3:41389365-41389387 CAGGGTAATCAGGCAGGAGAAGG - Intronic
955279193 3:57578117-57578139 CAGAGTAATAAAAGGGGGGTGGG + Intronic
959495704 3:107048869-107048891 CAGGGTAGGGAAAGAGGGAAAGG + Intergenic
959638099 3:108598661-108598683 GATGGTAATCAAATAGGGAATGG - Intronic
960997854 3:123351513-123351535 GATGGTAATCTAAGATGGGAGGG + Intronic
961245927 3:125453321-125453343 CTGGGTACTGAAGGAGGGGAGGG + Intronic
961939399 3:130622079-130622101 CAGTGTAATTTAAGAGGGGAGGG + Intronic
962055230 3:131864700-131864722 CAGGGCAATCAAGCAGGAGAAGG - Intronic
962125344 3:132611371-132611393 CAGGGCAATCAAGCAGGAGAAGG + Intronic
962174248 3:133136337-133136359 CAGGGCAAGAGAAGAGGGGAGGG + Intronic
962188080 3:133281198-133281220 CAGGGCAAAAAAAGAGAGGATGG + Intronic
962667062 3:137664713-137664735 CAGGGCAATCAGACAGGAGAAGG + Intergenic
962697920 3:137969271-137969293 CAGGGCAATCAGACAGGAGAAGG + Intergenic
962925795 3:139992345-139992367 CAGGGTTATCAAAGAGAAGGAGG - Intronic
962996967 3:140639339-140639361 CAAGGTAAACAAAGAGCAGAAGG - Intergenic
963282109 3:143394599-143394621 CAGGGCAATCAGACAGGAGAAGG + Intronic
963792648 3:149600212-149600234 CAGTGTAATCAAATGGGGCAAGG + Intronic
964715688 3:159719090-159719112 CAGGTTTGTCAAAGATGGGATGG - Intronic
964763798 3:160158935-160158957 CAGGGTATTCTAGGAGAGGAAGG + Intergenic
967529603 3:190533491-190533513 CAGGGGAAGCACAGGGGGGAGGG - Intronic
969848613 4:9939125-9939147 CATGGTAATCAGAGAGGAAATGG - Intronic
970018840 4:11543917-11543939 CAGGGAAAACAACCAGGGGAAGG - Intergenic
970947508 4:21712415-21712437 CAGGCTAGTAAAAGATGGGAAGG - Intronic
971457292 4:26857407-26857429 CAGGGAAGTCAAAGACGGGAAGG + Intergenic
971500584 4:27314023-27314045 CAGAGCAATCAGAGAAGGGATGG + Intergenic
971504872 4:27355654-27355676 CAGGGTAATCAAAGAGAAACGGG - Intergenic
972915029 4:43866477-43866499 CAGGATGATCAAACAGGGGTTGG - Intergenic
973116426 4:46465786-46465808 CAGGGCAATCAGACAGGAGAAGG - Intronic
973361735 4:49171803-49171825 CAGGGCAATCAAGCAGGAGAAGG - Intergenic
973707626 4:53595709-53595731 CAGGGAAATCTAAGGGGGGAAGG + Intronic
974426385 4:61747855-61747877 CAGGGCAATCAAGCAGGAGAAGG + Intronic
975464468 4:74693857-74693879 CAGTGTAATCTAAGAGCAGAAGG + Intergenic
976918881 4:90411769-90411791 CAGGGCAATCAGGCAGGGGAAGG + Intronic
977598428 4:98909887-98909909 CAGGGTAATCATGGAGGAGGCGG + Intronic
977736935 4:100428002-100428024 CAGGGTGATCACAGAGTAGATGG - Intronic
978004472 4:103599448-103599470 CAGGGCAATCAGACAGGAGAAGG - Intronic
978225592 4:106330495-106330517 TAAGTTTATCAAAGAGGGGATGG - Intronic
978565856 4:110080739-110080761 CAGGGTAATCAGGCAGGAGAAGG + Intronic
980250357 4:130306953-130306975 CATGGTAATCAAAGTGGAAAGGG + Intergenic
980925793 4:139136107-139136129 CTGGGTAATCTAGGAGGGGATGG + Intronic
981459787 4:144999910-144999932 CAGGTTAATCAAAGATGAGATGG - Intronic
981493550 4:145367043-145367065 CAGGGCAATCAGACAGGAGAAGG - Intergenic
981554730 4:145980557-145980579 CAGTGCAATGACAGAGGGGAAGG + Intergenic
984066255 4:175051670-175051692 CAGGGGCATAAAGGAGGGGAGGG - Intergenic
984416820 4:179471234-179471256 AAGGGTAAGTTAAGAGGGGAAGG + Intergenic
986242817 5:5976641-5976663 CAGGGTGATCTCAGAGGAGAAGG + Intergenic
986703913 5:10439826-10439848 CAGGGTGAACACAGAGGTGATGG - Exonic
987893756 5:23917939-23917961 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
988176489 5:27732249-27732271 CAGGGCAATCAGGGAGGAGAAGG - Intergenic
988274108 5:29058085-29058107 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
988680704 5:33481213-33481235 AAGGGGAATGAAGGAGGGGATGG - Intergenic
989019657 5:36988047-36988069 TAGGGTAAGCTGAGAGGGGAGGG - Intronic
989190600 5:38666462-38666484 CAGGGTAGTAGAGGAGGGGATGG + Intergenic
989831373 5:45923751-45923773 CAGGGCAATCAGGGAGGAGAAGG - Intergenic
989838749 5:46031826-46031848 CAGGGAAATCAGACAGGAGAAGG + Intergenic
990060494 5:51640757-51640779 CAGGGCAATCAAGCAGGAGAAGG + Intergenic
990084349 5:51955931-51955953 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
991383559 5:66059531-66059553 CAGGGTAATCAGGCAGGAGAAGG - Intronic
994423866 5:99559737-99559759 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
995383923 5:111567583-111567605 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
996003094 5:118387105-118387127 CAGGGCAATCAGACAGGAGAAGG + Intergenic
996455486 5:123676555-123676577 CAGGGTAATCAGACAGGAGTAGG - Intergenic
998066011 5:139159281-139159303 CTGGGGCAGCAAAGAGGGGATGG + Intronic
998803554 5:145895282-145895304 CAGGGCAATCAAGCAGGAGAAGG + Intergenic
1000124415 5:158229650-158229672 CAGGGCAATCAGGGAGGAGAAGG + Intergenic
1000147142 5:158464616-158464638 GAGGGAAATGAAAAAGGGGAGGG - Intergenic
1000178916 5:158788175-158788197 CAGGATAATTAAAGATGGAAAGG + Intronic
1000431649 5:161159656-161159678 CATGGTAACCAAAATGGGGATGG + Intergenic
1001058690 5:168470212-168470234 CAGGGTAATGTCAGAGAGGAAGG - Intronic
1001560690 5:172667032-172667054 CAGGGAAACCAAAGACGGCATGG + Intronic
1001913331 5:175539164-175539186 CAGGAAAATCAAAGATGGAAAGG - Intergenic
1002468740 5:179422143-179422165 CATGGTCCCCAAAGAGGGGATGG + Intergenic
1002594570 5:180313638-180313660 TACGGGAATCCAAGAGGGGAGGG + Intronic
1003198699 6:3938887-3938909 CAGGGTAAGAAAGGAGGGAAAGG + Intergenic
1003411355 6:5865614-5865636 GAGGGTAATGAGAGTGGGGAAGG + Intergenic
1003863023 6:10339097-10339119 CAGTGTCATCAAAGAGAGGGAGG - Intergenic
1004299026 6:14440468-14440490 CAGGGCACTGAAAGTGGGGAGGG + Intergenic
1005363373 6:25053672-25053694 AAGGGGAGCCAAAGAGGGGATGG + Intergenic
1005558520 6:27012557-27012579 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1007467203 6:42062045-42062067 CAGGGAAAAAAAAGAGGAGAGGG - Intronic
1007921920 6:45617947-45617969 CAGGGAAAAGAAAAAGGGGAGGG - Intronic
1008552247 6:52644411-52644433 CAGGGTAAGTGAAGAGGGGCTGG - Intergenic
1009403382 6:63282559-63282581 CATGGCTATCAAAGAGGGGCTGG + Intronic
1009510512 6:64545518-64545540 CAGGGCAATCAGACAGGAGAAGG + Intronic
1010997255 6:82547958-82547980 CAGGGCAATCAAGCAGGAGAAGG + Intergenic
1011130073 6:84043570-84043592 CAGGGTCATTAAAAAAGGGAGGG - Intronic
1012220392 6:96641792-96641814 CAGGGCAATCAAGCAGGAGAAGG + Intergenic
1013619008 6:111871742-111871764 CAGGGGAAAGAACGAGGGGATGG + Intronic
1014143175 6:117966817-117966839 CAGGGTATTTAAAGAGGTAATGG - Intronic
1014630882 6:123788611-123788633 GAGGGAAATAAAAGAAGGGAAGG - Intergenic
1020385919 7:7602221-7602243 CAGGGCAATCAGACAGGAGAAGG + Intronic
1020580458 7:9992724-9992746 AAGGGTAATAAAAGAGGAGAAGG + Intergenic
1020849763 7:13337261-13337283 CAGAGTTATCAAAGAAGGTATGG - Intergenic
1023536151 7:41213900-41213922 CAATGTAATAAAAGAGGGGCTGG + Intergenic
1024011509 7:45270991-45271013 CAGGGGAAACAAATAGGGAAGGG + Intergenic
1026642376 7:72139195-72139217 CTGGGACATCAAAGAGGGGATGG - Intronic
1027195511 7:76027314-76027336 GAGGGGAATGGAAGAGGGGAGGG + Intronic
1027560843 7:79728062-79728084 CAGGGCAATCAAGCAGGAGAAGG + Intergenic
1028457883 7:91058400-91058422 CAGGGCAATCAGGCAGGGGAAGG - Intronic
1029298287 7:99558777-99558799 CCGGGTACTCACCGAGGGGAGGG - Exonic
1030449318 7:109689121-109689143 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
1030907869 7:115208934-115208956 CAGGGAAGTCAAACAGGGGGAGG - Intergenic
1031068392 7:117134020-117134042 CAGGGTAATCAAAGAGGGGAAGG - Intronic
1031626223 7:123996054-123996076 CAGTATAAACAAAGAGGGTAGGG + Intergenic
1031735369 7:125352980-125353002 CTGGGAACTCAAAAAGGGGAAGG + Intergenic
1034705659 7:153140773-153140795 CAGGTTTATCAAAGAGCAGATGG + Intergenic
1034892501 7:154853628-154853650 AAGAGTAATCAATGATGGGATGG - Intronic
1036011356 8:4728850-4728872 GAGATTAATAAAAGAGGGGAAGG + Intronic
1036370521 8:8158840-8158862 CAGGGCAATCAGGGAGGAGAAGG + Intergenic
1036880371 8:12506791-12506813 CAGGGCAATCAGGGAGGAGAAGG - Intergenic
1037162593 8:15791058-15791080 CAGGGTAATGGAAATGGGGATGG + Intergenic
1038158406 8:25013115-25013137 CAGGGCAATCAGAGAGGAGAAGG + Intergenic
1038450167 8:27634379-27634401 CAGAGGAAGCAAAGAGGAGAGGG + Intronic
1038919508 8:32067182-32067204 CAGGGCAATCAGACAGGAGAAGG - Intronic
1039561024 8:38512629-38512651 GAGGGTAATGACTGAGGGGATGG + Exonic
1039610548 8:38915572-38915594 CAGGGTCTTTAAAGAGGTGACGG - Intronic
1040469163 8:47722555-47722577 GAGTGTAATAAAAGAAGGGAAGG - Intronic
1040479390 8:47809806-47809828 CAGGGAAATCAAAACTGGGAAGG + Intronic
1040531918 8:48272946-48272968 CAGGTTTATCAAAGAGCAGATGG - Intergenic
1040539103 8:48335937-48335959 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1040541035 8:48355875-48355897 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1040647363 8:49414950-49414972 CATAGTCATCAAAGATGGGATGG - Intergenic
1040667467 8:49651637-49651659 CAAAGTCATCAAAAAGGGGAAGG - Intergenic
1040953801 8:52960039-52960061 CAAAGCCATCAAAGAGGGGAAGG + Intergenic
1041755145 8:61305338-61305360 GTGGTTAATCAGAGAGGGGAAGG - Intronic
1043178015 8:77046262-77046284 CAGGGCAATCAAGCAGGAGAAGG + Intergenic
1043718464 8:83512920-83512942 CAGGGTAGACAATGAGGGTACGG + Intergenic
1044438883 8:92199642-92199664 CAGGGCAATGTAAGAGGAGAAGG - Intergenic
1044926774 8:97215822-97215844 CAGGGGAATCCACGATGGGAGGG + Intergenic
1045116185 8:98983361-98983383 CATGTTAATCAAGGAGGGCATGG - Intergenic
1045598171 8:103681416-103681438 AAGGGAAATCAAATTGGGGAAGG + Intronic
1046218528 8:111181679-111181701 CAGGGCAATCAAGCAGGAGAAGG - Intergenic
1047097710 8:121641754-121641776 CAGGGAAATCCAAGAGGCGAGGG - Intergenic
1047204202 8:122790380-122790402 AAGAGGAATCAAAGCGGGGAGGG - Intronic
1047413177 8:124640867-124640889 CAGTATAAATAAAGAGGGGATGG - Intronic
1047473003 8:125197481-125197503 CAGGTTTATCAAAGATCGGATGG + Intronic
1050007512 9:1148345-1148367 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1050194428 9:3066022-3066044 CAGGGGAATCAAAGATGAGGAGG - Intergenic
1050901155 9:10950640-10950662 CAGGGCAATCAAGCAGGAGAAGG + Intergenic
1050960223 9:11720670-11720692 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1051082264 9:13307387-13307409 CAGGGAAATCAAAGAGGGGAGGG - Intergenic
1051090720 9:13404572-13404594 CAGGGCAATCACACAGGAGAAGG - Intergenic
1051940939 9:22504870-22504892 CAGGGCAATCAAGCAGGAGAAGG - Intergenic
1052111905 9:24596162-24596184 CAGGAAAAACAAAGAGGGGGAGG - Intergenic
1052640129 9:31156942-31156964 CAGGGTAATCAGGAAGGAGAAGG - Intergenic
1053564458 9:39233790-39233812 CATGGTAATAACAGAGGTGAGGG + Intronic
1053612730 9:39731756-39731778 CTGGGTCATCATAGAGGAGATGG + Intergenic
1053637913 9:40033710-40033732 CAGGGTAATTAGGCAGGGGAAGG + Intergenic
1053718368 9:40919923-40919945 CAGGGTAATCAGGCAGGAGAGGG + Intergenic
1053768169 9:41431510-41431532 CAGGGTAATTAGGCAGGGGAAGG - Intergenic
1053830240 9:42071692-42071714 CATGGTAATAACAGAGGTGAGGG + Intronic
1053870772 9:42489718-42489740 CTGGGTCATCATAGAGGAGATGG + Intergenic
1054085523 9:60739399-60739421 CTGGGTCATCATAGAGGAGATGG - Intergenic
1054132693 9:61385246-61385268 CATGGTAATAACAGAGGTGAGGG - Intergenic
1054165456 9:61722666-61722688 CAGGGCAATCAAGCAGGAGAAGG + Intergenic
1054240786 9:62610634-62610656 CTGGGTCATCATAGAGGAGATGG - Intergenic
1054546837 9:66343014-66343036 CAGGGTAATTAGGCAGGGGAAGG - Intergenic
1054554920 9:66645158-66645180 CTGGGTCATCATAGAGGAGATGG - Intergenic
1054600319 9:67115763-67115785 CATGGTAATAACAGAGGTGAGGG - Intergenic
1056909987 9:90690411-90690433 CAGGGAAATCAAGCAGGAGAAGG + Intergenic
1057283849 9:93731722-93731744 TAGGGTCATAAAAGAGGGAAGGG - Intergenic
1057302062 9:93892309-93892331 CAAGGTACCCAAAGAGAGGAGGG + Intergenic
1057406232 9:94773307-94773329 CAGGGAAAACAAGCAGGGGATGG + Intronic
1058434887 9:104953328-104953350 CAGGATACACAAAGAAGGGATGG + Intergenic
1059210558 9:112510992-112511014 CAGAGTGATCAAGCAGGGGATGG + Intronic
1060495297 9:124113744-124113766 CAGGGCAGGCAGAGAGGGGAGGG + Intergenic
1060992960 9:127859137-127859159 GAGGGTAAACAAAGAAGGAAGGG - Intergenic
1062308290 9:135921788-135921810 TAGGGTTATGAAGGAGGGGAGGG - Intergenic
1062534147 9:137014195-137014217 GTGGGTTATCAAAGAGGGGGCGG + Exonic
1062615368 9:137393719-137393741 CAGGGCTTTCACAGAGGGGAGGG + Intronic
1202785783 9_KI270719v1_random:17266-17288 CAGGGTAATTAGGCAGGGGAAGG + Intergenic
1186269447 X:7869209-7869231 GAGAGTAATCAAGGTGGGGATGG + Intergenic
1187453594 X:19421180-19421202 CAGGGTAATCAGGCAGGAGAAGG + Intronic
1187541098 X:20196168-20196190 CAGTGTAAGCAAAGATGTGAAGG + Intronic
1187849760 X:23580231-23580253 CAGTGTCAGCAAAGAGGTGAGGG - Intergenic
1188195414 X:27226462-27226484 CAGGGCAATCAAGCAGGAGAAGG + Intergenic
1188198064 X:27263515-27263537 CAGGGCAATCAAGCAGGAGAAGG + Intergenic
1188445408 X:30249095-30249117 CTGGGTACTCAGAGAGGTGAAGG + Intronic
1188621399 X:32229537-32229559 GAGTGTTATTAAAGAGGGGAGGG - Intronic
1189519542 X:41751622-41751644 CAGGGTGATCTAAGAGGTTAAGG + Intronic
1190392314 X:49944398-49944420 CAGGGCAATCAGGGAGGAGAAGG - Intronic
1190607916 X:52164051-52164073 CAGGGCAATCAGACAGGAGAAGG + Intergenic
1190967914 X:55319826-55319848 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1191233070 X:58112239-58112261 CAGGGAAATCAGGCAGGGGAAGG + Intergenic
1191573216 X:62659505-62659527 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
1191649699 X:63523263-63523285 CAGGGCAATCAGGCAGGGGAAGG + Intergenic
1191660732 X:63647224-63647246 CAGGGCAATCAGGCAGGGGAAGG - Intronic
1191683179 X:63862370-63862392 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
1191783006 X:64888670-64888692 CAGGGCAATCAGACAGGAGAAGG + Intergenic
1192073465 X:67965271-67965293 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1192194591 X:69019677-69019699 CAGGGACATCAGGGAGGGGAGGG + Intergenic
1192352140 X:70365236-70365258 CAGGGAAATCAGACAGGAGAAGG - Intronic
1192895915 X:75442300-75442322 CAGGGTAATCAGGCAGGAGAAGG + Intronic
1193312438 X:80024375-80024397 CACGGCATTCCAAGAGGGGATGG - Intronic
1193362678 X:80594547-80594569 CAGGGCAATCAAGCAGGAGAAGG + Intergenic
1193410971 X:81162570-81162592 CATGGAAATGGAAGAGGGGATGG - Intronic
1193476628 X:81974105-81974127 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1193735453 X:85150963-85150985 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1194630189 X:96273512-96273534 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1194814551 X:98426322-98426344 CAGGGCAATTAGGGAGGGGAAGG - Intergenic
1195372456 X:104191472-104191494 TAGGAGAACCAAAGAGGGGAAGG - Exonic
1195408925 X:104547848-104547870 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1195414974 X:104610279-104610301 CAGGGTAATCAGGCAGGAGAAGG + Intronic
1195925370 X:110019358-110019380 CAGGGGAATCAAAGAAGAAAAGG - Intronic
1196077167 X:111590692-111590714 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1196716856 X:118820764-118820786 CAGGGATATCAAAGACTGGATGG - Intergenic
1198839600 X:140842068-140842090 CAGGGTAATAAAGGATAGGATGG + Intergenic
1199227693 X:145396643-145396665 CAGGGAAGCCATAGAGGGGATGG - Intergenic
1199318906 X:146415059-146415081 CAGAGTGATGCAAGAGGGGAGGG + Intergenic
1200364720 X:155649766-155649788 CAGGGTAATCACACAAGAGAAGG + Intronic
1201620662 Y:15953554-15953576 CAAGGTAGTCAAATAGAGGATGG + Intergenic
1201626479 Y:16020425-16020447 CAGGGTAATCAGACAGGAGAAGG - Intergenic
1201732233 Y:17216885-17216907 CAGGGCAATCAAGCAGGAGAAGG + Intergenic
1201974690 Y:19836096-19836118 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1202034312 Y:20616141-20616163 CAGGTTAATCAAAGATCAGATGG + Intergenic