ID: 1031069261

View in Genome Browser
Species Human (GRCh38)
Location 7:117143699-117143721
Sequence TGAGTACTAAACTAGCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 65}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031069261_1031069266 7 Left 1031069261 7:117143699-117143721 CCAGGGTGCTAGTTTAGTACTCA 0: 1
1: 0
2: 0
3: 1
4: 65
Right 1031069266 7:117143729-117143751 GGGTAGATGTCAGGATTAAACGG No data
1031069261_1031069267 8 Left 1031069261 7:117143699-117143721 CCAGGGTGCTAGTTTAGTACTCA 0: 1
1: 0
2: 0
3: 1
4: 65
Right 1031069267 7:117143730-117143752 GGTAGATGTCAGGATTAAACGGG 0: 1
1: 0
2: 0
3: 18
4: 181
1031069261_1031069264 -2 Left 1031069261 7:117143699-117143721 CCAGGGTGCTAGTTTAGTACTCA 0: 1
1: 0
2: 0
3: 1
4: 65
Right 1031069264 7:117143720-117143742 CACCTCACAGGGTAGATGTCAGG 0: 1
1: 0
2: 5
3: 42
4: 297
1031069261_1031069268 30 Left 1031069261 7:117143699-117143721 CCAGGGTGCTAGTTTAGTACTCA 0: 1
1: 0
2: 0
3: 1
4: 65
Right 1031069268 7:117143752-117143774 GATAATTCAAGCAAAGTACTTGG 0: 1
1: 0
2: 2
3: 34
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031069261 Original CRISPR TGAGTACTAAACTAGCACCC TGG (reversed) Intronic
910338230 1:86156711-86156733 TGAGTGCTGCACTAGCAGCCCGG - Exonic
911943722 1:104078532-104078554 TGAGTTCTAAACTAGCAAAATGG + Intergenic
914333074 1:146690469-146690491 TGAGTCCTACTCTATCACCCAGG + Intergenic
917299229 1:173555586-173555608 TGAGAAGTTAACTAGCACCTGGG - Intronic
918273700 1:182929447-182929469 TGAGTACTAACCTTGTAGCCAGG - Intronic
920018565 1:202935248-202935270 TGAGAACTAGACTAACACACAGG + Intergenic
920408317 1:205737105-205737127 TAAATACTAAAGCAGCACCCAGG + Intronic
1063833664 10:9986667-9986689 TGATTACTAAAATAGCTTCCTGG - Intergenic
1072152998 10:92698514-92698536 TGAATACCAAACAATCACCCAGG + Intergenic
1078865595 11:15294433-15294455 AGAGGAATGAACTAGCACCCTGG + Intergenic
1081753804 11:45530783-45530805 TGATTTGTAAACCAGCACCCTGG - Intergenic
1086984593 11:93234274-93234296 GGAATAATGAACTAGCACCCAGG - Intergenic
1087165193 11:94996287-94996309 TGGGTATGAAACCAGCACCCAGG + Intronic
1109195645 13:59375212-59375234 TGGGTACTAAAAAAGCACCAAGG - Intergenic
1114081083 14:19201750-19201772 TGATTTCTGAACTAACACCCGGG + Intergenic
1125569501 15:40704997-40705019 TGAGTAACAAAGCAGCACCCTGG - Intronic
1132694910 16:1197753-1197775 TGAGTTCTCACCCAGCACCCAGG - Intronic
1138325881 16:56167125-56167147 TGAGTAACAAACTGGAACCCTGG - Intergenic
1140000546 16:71020781-71020803 TGAGTCCTACTCTATCACCCAGG - Intronic
1140065998 16:71611586-71611608 TGAGTGCTAAATTAACACACCGG + Intergenic
1160089647 18:75814495-75814517 TGAGAATTAAACCAGCATCCAGG - Intergenic
1160253171 18:77221818-77221840 TGAGTACTTAACTCAGACCCAGG + Intergenic
1161776068 19:6262811-6262833 TAGGTGCTAAACTAGAACCCAGG - Intronic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1167426842 19:49433988-49434010 TGAGTACTGCACAAGGACCCCGG + Exonic
938552209 2:132392821-132392843 GGAGTGCTAAGCTGGCACCCTGG + Intergenic
1172193307 20:33075299-33075321 TGAGGATTAAACCAGCACTCAGG + Intergenic
1180499690 22:15920936-15920958 TGATTTCTGAACTAACACCCGGG - Intergenic
1183754826 22:39750916-39750938 TGATGACTATACTAGCACCTGGG - Intronic
1184554079 22:45223645-45223667 TCAGCACTAAGCCAGCACCCAGG + Intronic
1184554089 22:45223693-45223715 TCAGCACTAAGCTAGCACCCAGG + Intronic
949896452 3:8770399-8770421 TGATTACTCAGCTAGAACCCTGG - Intronic
950658214 3:14450463-14450485 TGAGTACCAAGCTGGCAGCCAGG - Intronic
951031721 3:17889938-17889960 TCAGTAGTAAAATAGCACTCTGG + Intronic
955842923 3:63131037-63131059 TTAGTAAAACACTAGCACCCGGG - Intergenic
956034395 3:65074684-65074706 TGAGTGCTAATCTGTCACCCTGG + Intergenic
957529708 3:81425496-81425518 TTAGCACTCAATTAGCACCCAGG - Intergenic
961348292 3:126279010-126279032 TGAGTATTCACTTAGCACCCAGG + Intergenic
963123441 3:141794889-141794911 TGAGTACTAAACAGGGAACCAGG + Intronic
963519007 3:146341771-146341793 TGAGTACTAGACTATCTGCCAGG + Intergenic
976252787 4:83070358-83070380 TTAGTAGTAAACTAGAACCATGG - Intronic
981989379 4:150898757-150898779 AGAATACAAAACTAGCACCTAGG + Intronic
996641816 5:125763277-125763299 TGAGTACTATGCTGGCACCTGGG + Intergenic
1002183637 5:177443905-177443927 TGAGTACCAAACTAACCACCTGG + Intergenic
1003473619 6:6461309-6461331 TCGGTACTAAAATAGCACCTGGG - Intergenic
1005487092 6:26310959-26310981 TGAGCACTCAAATAACACCCTGG + Intergenic
1022923548 7:35038212-35038234 AGAGTATTAAAATAGCAGCCTGG + Intronic
1024046277 7:45587670-45587692 TGGTCACTAGACTAGCACCCTGG - Intronic
1024907930 7:54409991-54410013 GGAGTACTAACCTAGCACAGGGG - Intergenic
1026988948 7:74572167-74572189 TCAGTCCTACACTAGCATCCAGG - Intronic
1030183615 7:106737113-106737135 TGTGTGCTAAACTAGCCCCTTGG + Intergenic
1030285022 7:107817128-107817150 GGAGTTCTAGACTAGCAGCCTGG - Intergenic
1031069261 7:117143699-117143721 TGAGTACTAAACTAGCACCCTGG - Intronic
1032019616 7:128400069-128400091 TGAGTTTTCAACTAGCTCCCTGG + Intronic
1033509005 7:142035926-142035948 TGAGTACTAAATTACTACACAGG - Intronic
1041290927 8:56307784-56307806 TGCATGCTAAACTGGCACCCCGG + Intronic
1046860176 8:119082563-119082585 TCAGAACTAAACTAACTCCCTGG - Intronic
1053311264 9:37022014-37022036 CCAGTACTAAACTACAACCCAGG + Intronic
1053601664 9:39617145-39617167 TTAGTACTAAACTAGAAGCAGGG - Intergenic
1053859312 9:42370912-42370934 TTAGTACTAAACTAGAAGCAGGG - Intergenic
1054251871 9:62725301-62725323 TTAGTACTAAACTAGAAGCAGGG + Intergenic
1054565984 9:66759802-66759824 TTAGTACTAAACTAGAAGCAGGG + Intergenic
1185661432 X:1731993-1732015 TGAGTCTTAAACTGTCACCCAGG + Intergenic
1188098462 X:26051737-26051759 TGAGTACTAATCTAGCTGCAGGG - Intergenic
1196397930 X:115286008-115286030 TGAGCACAAATCTAGCATCCAGG - Intergenic
1198407040 X:136323464-136323486 TGATGACAAAACTAGCAACCTGG - Intronic
1201584227 Y:15543187-15543209 TGGTTTCTAGACTAGCACCCAGG - Intergenic