ID: 1031076966

View in Genome Browser
Species Human (GRCh38)
Location 7:117222138-117222160
Sequence TGGGGTTGCCTTACAGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031076958_1031076966 29 Left 1031076958 7:117222086-117222108 CCTTGGGGAATGGATGGGGAAAG 0: 1
1: 0
2: 3
3: 35
4: 340
Right 1031076966 7:117222138-117222160 TGGGGTTGCCTTACAGAAATGGG 0: 1
1: 0
2: 0
3: 8
4: 110
1031076961_1031076966 6 Left 1031076961 7:117222109-117222131 CCAAGGGCATAAAAGCAGCGTGA 0: 1
1: 0
2: 0
3: 4
4: 97
Right 1031076966 7:117222138-117222160 TGGGGTTGCCTTACAGAAATGGG 0: 1
1: 0
2: 0
3: 8
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031076966 Original CRISPR TGGGGTTGCCTTACAGAAAT GGG Intronic
900029970 1:364345-364367 TGGGGTTGCATCACAGAGTTTGG - Intergenic
907326460 1:53641604-53641626 TGGGGTTGTCACACAGAGATTGG + Intronic
907412821 1:54294549-54294571 TGGGGTGGCCTCACAGAGCTGGG + Intronic
908564777 1:65343115-65343137 TGGTGTTTCCTCACAGAACTGGG - Intronic
911366853 1:96949003-96949025 TGGGGTTGAATTTCAAAAATGGG - Intergenic
918220031 1:182428290-182428312 TGGGGTTTCCATGCAAAAATGGG + Intergenic
923712435 1:236397918-236397940 TATGGTTTCATTACAGAAATAGG - Intronic
1064367953 10:14725268-14725290 TAGGGTTGCCTTATAGAGAATGG + Intronic
1064757358 10:18583278-18583300 AGGGGTTGCCTTATAGGAGTTGG - Intronic
1064875040 10:19984202-19984224 TGGAGTGGCCATCCAGAAATGGG - Intronic
1067043795 10:42973100-42973122 TGGGGTGGCCTTAGACTAATGGG - Intergenic
1076442152 10:130487382-130487404 GGGGGTTGCTTTACAGGAGTTGG - Intergenic
1084791527 11:71478049-71478071 TGGGGGTGTCTTACTGACATGGG + Intronic
1089619033 11:119712038-119712060 TGGGCTTTCATCACAGAAATGGG + Intronic
1090497023 11:127223078-127223100 TGTGGATGCCTGAAAGAAATGGG - Intergenic
1090592431 11:128286784-128286806 TGGGGTTACCATACACTAATTGG - Intergenic
1090610528 11:128466930-128466952 TGGGGTTTCTCTACAGGAATCGG - Intronic
1091473516 12:751811-751833 AAGGGCTGCCTTACTGAAATCGG - Intergenic
1100862350 12:98819581-98819603 TGGGGCTGCCTTACAAAGAGCGG + Intronic
1101656033 12:106720868-106720890 TGGGGTGGCCTTACCGAAGCTGG - Exonic
1101838178 12:108309719-108309741 TGGGCTTGCATTACAGAACAGGG + Intronic
1103570786 12:121843464-121843486 TGGGGCTGCTTTACAGAGACTGG - Intronic
1103592299 12:122000788-122000810 TGGGGCTGGCATAGAGAAATAGG - Intronic
1104033190 12:125079816-125079838 TGGGGTTTCCTTTCGGAAAATGG - Intronic
1104728314 12:131091565-131091587 TGGCGTGGCTTTACAAAAATGGG - Intronic
1107677564 13:42812634-42812656 TGGAGCTGACTTAAAGAAATGGG - Intergenic
1119168820 14:72517013-72517035 TCGTCTTGCCTTGCAGAAATTGG + Intronic
1120110633 14:80551229-80551251 TTGGCATGCCTTCCAGAAATAGG - Intronic
1124183833 15:27503224-27503246 TGGAGTTGCATGACAGAAAATGG + Intronic
1126370833 15:47945352-47945374 TGGGGTTGCCTCAAAGATGTAGG + Intergenic
1127428548 15:58880095-58880117 TGGGGATGCGTTACTGAAAAAGG + Exonic
1128679402 15:69637000-69637022 TGGGGTTGCCTGAAGGGAATGGG + Intergenic
1130677825 15:85969216-85969238 AAGGGTTGCCTCAAAGAAATTGG - Intergenic
1138170491 16:54844754-54844776 TGAGGTTGCATTTAAGAAATGGG + Intergenic
1138723955 16:59115889-59115911 TTGGCTTTCCTTACAGATATAGG + Intergenic
1139185915 16:64805894-64805916 TGGGCTTGTCTTTCAGAAATTGG + Intergenic
1145391931 17:22461853-22461875 TGGGGTGGCCGACCAGAAATGGG - Intergenic
1151052750 17:70996947-70996969 TTGGGTTTCCTTACAGGATTGGG - Intergenic
1151641834 17:75401110-75401132 TTATTTTGCCTTACAGAAATAGG - Intronic
1152949787 17:83222215-83222237 TGGGGTTGCATCACAGAGTTTGG + Intergenic
1156202518 18:34850763-34850785 TGGTGTTGTTTTACAAAAATGGG - Intronic
1158516235 18:58132328-58132350 TGGGGCTGCCACACAGGAATGGG + Intronic
1160302852 18:77701874-77701896 TGTGATTTCATTACAGAAATGGG + Intergenic
1162932676 19:13965239-13965261 GGGGGTTGCATTTCAGAAGTGGG + Intronic
1165586715 19:36923127-36923149 AGTGGTTGCCTTTCAGGAATGGG - Intronic
926574815 2:14568436-14568458 TGGATTTGTCTTACAGAAACGGG + Intergenic
928791045 2:34953935-34953957 AAGGGATGCATTACAGAAATAGG + Intergenic
934686815 2:96327288-96327310 CGGGGCTGCCTTTGAGAAATGGG + Exonic
935469857 2:103445248-103445270 AGGGGTTGCCTGACATAAAAGGG - Intergenic
935553099 2:104479200-104479222 TGGAGCAGCCTTACAAAAATGGG - Intergenic
935791771 2:106598686-106598708 TGGAGTTGCATTACAGCTATAGG + Intergenic
936282248 2:111152287-111152309 TGGGGCTGCCTGAGAGAAAGAGG + Intronic
939774340 2:146365949-146365971 TGGGTATGCCTCATAGAAATGGG + Intergenic
940575530 2:155499255-155499277 TGGGATTGATTTATAGAAATAGG - Intergenic
946052793 2:216878169-216878191 AGAGGCTGCCTTACAGAGATGGG - Intergenic
947359011 2:229328215-229328237 TGGGGTTGCCTTAAATCTATGGG - Intergenic
947878637 2:233485735-233485757 TGGGGCTGTCTCAGAGAAATTGG - Intronic
1170993978 20:21334075-21334097 CAGGGTTACCTTACAGAAAGTGG + Exonic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1174698386 20:52583011-52583033 TGGGGTTTTTTTACAGAAAAGGG + Intergenic
1177257463 21:18684000-18684022 TCTGTTTGCCTTACAAAAATAGG + Intergenic
1181489897 22:23255083-23255105 TGGAGCTTCCTTACAGAAATGGG - Intronic
949294828 3:2509377-2509399 ACTGGTTACCTTACAGAAATTGG + Intronic
950042402 3:9928594-9928616 TAGGGTGGCCTTTCAGCAATGGG - Exonic
958021955 3:88008360-88008382 TGGGATTGCCTTGCAGACACTGG - Intergenic
961615366 3:128175190-128175212 TGGGGTTGACTTGGAGAAAAGGG - Intronic
963286895 3:143442087-143442109 TGGTTTGGCCTTACTGAAATAGG + Intronic
966916464 3:184586998-184587020 TGGGGATGACTTACGGAAAAGGG - Intronic
967547371 3:190747360-190747382 TGGTGTTAAATTACAGAAATGGG + Intergenic
967798771 3:193630259-193630281 TGTGCTTGCTGTACAGAAATGGG + Intronic
968187545 3:196643618-196643640 TGGGGTTGCCTTAGACACTTAGG - Intronic
969264446 4:6055746-6055768 TGGGGATACCCTGCAGAAATGGG - Intronic
969264613 4:6056361-6056383 TGGGGATACCCTGCAGAAATAGG - Intronic
970397708 4:15686063-15686085 GTGGTTTGCCTTACAGAAATAGG + Intronic
972184884 4:36516553-36516575 TGGGCTTGCAATACAGAAATGGG + Intergenic
974410145 4:61530351-61530373 TGGTCTTGCCATACAGAAATTGG + Intronic
977071758 4:92399061-92399083 TGTGGATGGCTTACAGAAACTGG - Intronic
980581681 4:134762373-134762395 CGAGGTTGCCTTCCAGAAACTGG + Intergenic
981235005 4:142405468-142405490 TGGAAGTACCTTACAGAAATAGG + Intronic
987531632 5:19129537-19129559 TGGGTTTACCTTCCAGAAAAGGG - Intergenic
991152285 5:63384516-63384538 TGGAATTGCCATACATAAATTGG - Intergenic
992095510 5:73358980-73359002 TGGGGTGCCCTTACAAAAAGAGG - Intergenic
997906608 5:137823307-137823329 TGTGGTTGCCTTGGAGAAATTGG - Intergenic
1000353233 5:160369148-160369170 AGGGGTTACCTTTCAGAATTGGG + Intronic
1002372653 5:178767504-178767526 TGAAATTGCCTTTCAGAAATAGG - Intergenic
1002434611 5:179222929-179222951 AGGGGTTGCCTGGCAGAAAGTGG - Intronic
1002744019 5:181456027-181456049 TGGGGTTGCATCACAGAGTTTGG + Intergenic
1003763415 6:9208696-9208718 TGGAAATGCCTTACAGAACTGGG + Intergenic
1007040484 6:38716762-38716784 TGGGATAGGGTTACAGAAATGGG + Intronic
1007983062 6:46179046-46179068 TGGAGTTGCCATCCAGAGATGGG + Intergenic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1016341374 6:143064930-143064952 AGGGGTTGCTTTATAGAAGTTGG + Intronic
1017072981 6:150592772-150592794 TGGGGTGGACTTACAGGAACTGG + Intergenic
1018229773 6:161664156-161664178 TGGGGTTGCTTTACATAACCTGG - Intronic
1019248878 6:170729256-170729278 TGGGGTTGCATCACAGAGTTTGG + Intergenic
1022804356 7:33807157-33807179 TGGAGTTTCCATACAGAAAATGG - Intergenic
1024208251 7:47182066-47182088 TGGGATTGGCTTACATGAATTGG - Intergenic
1025949948 7:66136725-66136747 TGGGATTGCCTTACATCTATAGG + Intronic
1026380114 7:69791103-69791125 TGGGGCTGAGTTACATAAATTGG - Intronic
1027388351 7:77680428-77680450 TGGAGTTGCTTTTCAGTAATGGG - Intergenic
1030608419 7:111663133-111663155 GGAGGTTGCCTAACAGAATTTGG + Intergenic
1030813332 7:114003697-114003719 TGGGCTTGCCTTCCTGATATGGG - Intronic
1031076966 7:117222138-117222160 TGGGGTTGCCTTACAGAAATGGG + Intronic
1033007557 7:137583785-137583807 TGTGTTTGACTTATAGAAATTGG - Intronic
1036562765 8:9911179-9911201 TGTGTTTGCCTTAGAGAACTTGG + Intergenic
1037913613 8:22758885-22758907 TGGGGTTTCATGACAGAAAGAGG + Intronic
1040356828 8:46626707-46626729 TGGGGTTGCCTTTCATTAAAAGG - Intergenic
1045225610 8:100242240-100242262 TGGAGTTTACTTACAGAAATGGG + Intronic
1057199187 9:93131338-93131360 TAGGGTTGCCTTTTAGAACTTGG + Intronic
1059573924 9:115469829-115469851 TTGAGTTGCCTAACAGAAATGGG - Intergenic
1059803966 9:117778540-117778562 TAGGGTTGCTTTAAAAAAATAGG - Intergenic
1060054034 9:120398051-120398073 TAGGGTTCCCTTGGAGAAATGGG - Intronic
1061043604 9:128152936-128152958 TGGGGGTTCCTTTCAGAGATGGG - Intronic
1061571916 9:131483132-131483154 TTGGGTGGCCTGACAGAAACAGG - Intronic
1203609833 Un_KI270748v1:86520-86542 TGGGGTTGCATCACAGAGTTTGG + Intergenic
1192860875 X:75069170-75069192 TGGGGTTTCCTAACATTAATAGG - Intronic
1195412568 X:104584073-104584095 TGGGGTGGGGGTACAGAAATAGG - Intronic
1196469586 X:116010845-116010867 AGGGGTTGCTTTACAGGAGTTGG - Intergenic
1198096111 X:133381361-133381383 TGAGCTTGTCTTCCAGAAATAGG + Intronic