ID: 1031083528

View in Genome Browser
Species Human (GRCh38)
Location 7:117280547-117280569
Sequence TTTGCACATGACTGTACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031083528_1031083531 16 Left 1031083528 7:117280547-117280569 CCCACAGTACAGTCATGTGCAAA No data
Right 1031083531 7:117280586-117280608 AGCTCAAAGACAGTCAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031083528 Original CRISPR TTTGCACATGACTGTACTGT GGG (reversed) Intronic