ID: 1031084580

View in Genome Browser
Species Human (GRCh38)
Location 7:117289907-117289929
Sequence CCGGGATGATGGAGGTGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031084570_1031084580 8 Left 1031084570 7:117289876-117289898 CCTTGACACATTTAAGAGGTCCC 0: 1
1: 0
2: 0
3: 3
4: 89
Right 1031084580 7:117289907-117289929 CCGGGATGATGGAGGTGACAAGG 0: 1
1: 0
2: 0
3: 27
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031084580 Original CRISPR CCGGGATGATGGAGGTGACA AGG Intronic
901078750 1:6571811-6571833 GGGGGAGGATGGAGGGGACAAGG - Intronic
901839945 1:11947920-11947942 GGAGGATGAGGGAGGTGACAGGG - Intronic
901845642 1:11980471-11980493 CCGGGAAGGTGAAGGTGAGAGGG + Exonic
902378321 1:16040776-16040798 CCGGGCTGATGGAGCAGAGATGG - Intergenic
903028529 1:20446371-20446393 CTGGGGTGATGGAAGTGACTGGG + Intergenic
903246924 1:22022983-22023005 CTGGGGTCATGGTGGTGACAGGG + Intergenic
903282845 1:22259765-22259787 TCGGGATGGGGGTGGTGACAAGG + Intergenic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
906291474 1:44622340-44622362 TTGGGGTGATGGAGCTGACAGGG - Intronic
911840328 1:102674762-102674784 CTGGGATGATGAAGGCAACAGGG - Intergenic
915282385 1:154831335-154831357 CAGGGAGGATGGAGGTGGGATGG + Intronic
916051823 1:161041801-161041823 CAGTGATGATGCAGTTGACACGG - Exonic
919179503 1:194062193-194062215 CAGGGATGATGGAGTTCACATGG - Intergenic
919362334 1:196610727-196610749 CTGGGATGCTGGAGGTTAGAGGG + Intergenic
919858295 1:201720405-201720427 CCAGATTGATGGAGGTGACGGGG + Intronic
919990246 1:202704326-202704348 CCAGGCTGATAGAGGAGACACGG + Intronic
1064300687 10:14120153-14120175 CAGGGATGATGGAGGTATAAAGG - Intronic
1068630129 10:59289711-59289733 CGGGCATGATGGAAGTGAAATGG - Intronic
1069277606 10:66612120-66612142 TTGTGATGATGGAGGTGAAAGGG - Intronic
1069619600 10:69828655-69828677 CAGGGATGATGTAGCTGACATGG - Intronic
1069751173 10:70745879-70745901 CTGGGGTCATGGAGGTGGCAGGG + Intronic
1070442140 10:76456824-76456846 AAGGGAAGAAGGAGGTGACATGG - Intronic
1070566240 10:77605665-77605687 CCCAGTTGAGGGAGGTGACAGGG + Intronic
1073453098 10:103621091-103621113 CAGGGAGGCTGGATGTGACAGGG + Intronic
1073476475 10:103756983-103757005 CAGGGTTGATAGAGGTGAGAGGG - Intronic
1075936869 10:126350516-126350538 CTAGAATGATGGAGTTGACAGGG - Intronic
1077281815 11:1749377-1749399 CCGGGGAGATGGAGGTGGCGCGG - Intronic
1078153274 11:8776905-8776927 CAGAGATGATGGGGGTCACATGG + Intronic
1079099821 11:17534167-17534189 CCGGGAGGCTGGAGGAGAGAGGG - Intronic
1080514709 11:33009554-33009576 CCTGGGAGATGGAGGTTACAGGG + Intergenic
1081164647 11:39792578-39792600 ATGGGATGTTGCAGGTGACATGG + Intergenic
1081226595 11:40531287-40531309 TCAGGATGAAGGAGGTGAAATGG - Intronic
1083681480 11:64353822-64353844 CCAGCCTGAGGGAGGTGACAGGG - Intronic
1083764967 11:64837286-64837308 AGGGGAAGATGGTGGTGACAAGG + Intronic
1084095166 11:66906603-66906625 CTGGGGGGATGGAGGTGACGTGG - Intronic
1084329653 11:68423034-68423056 CCTGGAAGGTGGAGGAGACAGGG + Intronic
1085391675 11:76185355-76185377 CCTCCATGAGGGAGGTGACACGG + Intergenic
1088805387 11:113347698-113347720 AAGGAATGATGGAGGTAACAAGG - Intronic
1089098985 11:115944669-115944691 CCTGCATCAGGGAGGTGACAGGG - Intergenic
1090170163 11:124594868-124594890 CAGAGCTAATGGAGGTGACATGG - Intergenic
1090992749 11:131834524-131834546 GGGTGATGATGAAGGTGACAGGG - Intronic
1091632590 12:2173163-2173185 GTGGGATGATGGAGGGGACTGGG + Intronic
1092038369 12:5361705-5361727 AAGGGATGATGGAGGTGATCGGG - Intergenic
1094220656 12:27989624-27989646 CTGGGAAGATGGAGGTGACTGGG + Intergenic
1095214682 12:39534182-39534204 GGGGCATGATGGATGTGACAGGG - Intergenic
1097990301 12:65825761-65825783 CCGGGAGGAAGGAGGTGCCGGGG + Intronic
1099750892 12:86771187-86771209 CTGAGATCATGGTGGTGACAGGG - Intronic
1101220535 12:102634445-102634467 CCGGAATGATTGAGGATACAGGG - Intergenic
1102467831 12:113140722-113140744 CGAGGATGATGGAGCAGACATGG + Intergenic
1102781000 12:115564425-115564447 GCGGGATGATGTTGGTGGCAGGG - Intergenic
1103507538 12:121452138-121452160 CCGGGCTGAGGGAGGGGAAAGGG + Intronic
1103556307 12:121768741-121768763 CTGGGATGTTGAAGGTTACAGGG + Intronic
1105337916 13:19491747-19491769 CCCGGGAGATGGAGGTTACAGGG + Intronic
1107987172 13:45785631-45785653 CCCGAGTGATGGAGGTGACCTGG + Intronic
1111135917 13:84043415-84043437 ACTGGATGATGGCGGGGACAGGG + Intergenic
1113200889 13:107866967-107866989 GGGCGATGGTGGAGGTGACAGGG + Intergenic
1113382139 13:109813773-109813795 CCACTATGATGCAGGTGACATGG - Intergenic
1113698927 13:112368547-112368569 CCCGGATGGTGGAGGAGACAAGG + Intergenic
1116825898 14:49673162-49673184 CCTGGATGAAGGAAGTGGCAAGG - Intronic
1117010258 14:51463822-51463844 TGGGGGTGATGGAGGGGACAGGG + Intergenic
1118776311 14:68976571-68976593 CGGGGTTGATGGAGGGGCCATGG - Intronic
1122323485 14:100869023-100869045 CGAGGATGATGGAGGTGAGGCGG - Intergenic
1125918676 15:43511350-43511372 CATGGAAGATGCAGGTGACAAGG - Intronic
1126758106 15:51943622-51943644 CCTGGGAGATGGAGGTGGCAGGG + Intronic
1127461796 15:59206015-59206037 CTGGGATGATGGATGAGACCAGG + Intronic
1128705960 15:69837618-69837640 CTGGGATGCTGGAGGGGTCAGGG + Intergenic
1129263773 15:74383241-74383263 CAGGGCTGATGGGGGTGACACGG - Intergenic
1130669037 15:85894029-85894051 CCGGCATGCTGGATGTTACATGG - Intergenic
1132326745 15:100976936-100976958 CCGGGAAGATGGAGGGAATATGG + Intronic
1133840232 16:9401535-9401557 TGGTGATGATGGAGGTGACAAGG - Intergenic
1135840426 16:25871162-25871184 GCGGGGTGATGGAGGTGGCAGGG + Intronic
1136687215 16:32002637-32002659 CCGGTCTGATGGAGGAGACACGG + Intergenic
1136881955 16:33907601-33907623 CCAGTCTGATGGAGGAGACACGG - Intergenic
1139121718 16:64026799-64026821 CCGGGTTGAGGGAGATGACATGG - Intergenic
1139365412 16:66429435-66429457 CTGGGATCCTGGAGGTGGCAAGG + Intronic
1139421868 16:66853978-66854000 CCAGCATGCTGGAGGTGACGTGG + Exonic
1139847977 16:69934063-69934085 CCGGGTTGATGGAGGAGGCGGGG - Exonic
1140287231 16:73615289-73615311 CAGAGATGACGGATGTGACAGGG + Intergenic
1141070220 16:80947732-80947754 CCAGGGTGATAGAGTTGACATGG + Intergenic
1141768546 16:86074711-86074733 CTGGGGTGCTGGAGGTGACTGGG + Intergenic
1141976220 16:87518198-87518220 TCGGGATGCTGGCGGTTACATGG + Intergenic
1142409321 16:89908075-89908097 CTGGGAGGAGGGAGGAGACAGGG - Intronic
1203090056 16_KI270728v1_random:1207845-1207867 CCAGTCTGATGGAGGAGACACGG + Intergenic
1142562688 17:820201-820223 CTGTGATGATGGTGGTAACATGG + Intronic
1142688862 17:1592876-1592898 CCAGGATGACGGAGGAGACGGGG + Intronic
1143090037 17:4444727-4444749 CCAGGATGGTGAAGGTGAGATGG - Intronic
1143140869 17:4741052-4741074 CCGGGAGGCAGGAGGTGGCAAGG + Exonic
1143592432 17:7893732-7893754 CTGGAATTATGGAGGTCACAGGG - Intronic
1146085082 17:29820866-29820888 CTGGGAAGAGAGAGGTGACAAGG - Intronic
1147148193 17:38498306-38498328 CCGGTCTGATGGAGGAGACATGG + Intronic
1148223950 17:45885154-45885176 CCGGGATGAAAGAGTTGAGAAGG - Intergenic
1148891909 17:50814107-50814129 CCAAGATGATGGATGTGACCAGG - Intergenic
1153869577 18:9304897-9304919 TCAGGATGATGCAGGTGACCAGG + Intergenic
1156360702 18:36382070-36382092 CCGGGAGGTTGGAGGTGAGATGG + Intronic
1157618312 18:49001047-49001069 CAGGGAAGGTGGAGGTGGCAGGG + Intergenic
1161016793 19:1987332-1987354 CAGGGACGATGGAGGGGACCGGG - Intronic
1161816439 19:6502398-6502420 CCGGGATGATGGAGGGGGCTGGG + Exonic
1162554711 19:11379636-11379658 TTGAGATGAGGGAGGTGACAGGG - Intronic
1162913334 19:13861748-13861770 CCGGGCTGATGGAGTTGAGAAGG + Intergenic
1162951059 19:14072467-14072489 CCGGGACGATGACGGGGACATGG + Intergenic
1165216058 19:34273596-34273618 CCTGGGGGTTGGAGGTGACAGGG + Intronic
1165489597 19:36115553-36115575 GCGGCAAGATGGAGGTGACGGGG + Exonic
1166353944 19:42216251-42216273 ACAGGATGATGGAGCTGACAAGG - Intronic
1166670870 19:44708929-44708951 CCAGTCTGAGGGAGGTGACATGG - Intronic
1166670912 19:44709180-44709202 CCAGTCTGATGGAGGAGACATGG - Intronic
1166670930 19:44709264-44709286 CCAGTCTGATGGAGGAGACATGG - Intronic
1166670948 19:44709348-44709370 CCAGTCTGATGGAGGAGACATGG - Intronic
1166670982 19:44709516-44709538 CCGGTCTGATGGAGGAGACATGG - Intronic
1166671001 19:44709600-44709622 CCAGTCTGATGGAGGAGACATGG - Intronic
1166671018 19:44709684-44709706 CCAGTCTGATGGAGGAGACATGG - Intronic
1166671027 19:44709726-44709748 CCAGTCTGATGGAGGAGACATGG - Intronic
1166671036 19:44709768-44709790 CCAGTCTGATGGAGGAGACATGG - Intronic
1166671053 19:44709852-44709874 CCAGTCTGATGGAGGAGACATGG - Intronic
1168280572 19:55303395-55303417 CCGGAATGATGTTGGTGAGAAGG + Exonic
925286261 2:2717506-2717528 CCTGTATCATAGAGGTGACAGGG - Intergenic
926287723 2:11503192-11503214 CTGGGATGAGGGAGGAGAAAAGG - Intergenic
927663730 2:25014925-25014947 GCTGGAAGATGGAGGTGAGATGG + Intergenic
927990016 2:27441394-27441416 CAGGGGTGGGGGAGGTGACAAGG + Intronic
930193796 2:48488245-48488267 CGTGGATGAAGGAGGTGAAAGGG - Intronic
932343324 2:70979952-70979974 AGGGGTTGCTGGAGGTGACAAGG + Intronic
933178474 2:79203077-79203099 GAGAGATGATGGAGGTGGCAGGG - Intronic
936126039 2:109789828-109789850 CTGGGAGCATGGAGGTGAAAAGG + Intergenic
936218654 2:110581640-110581662 CTGGGAGCATGGAGGTGAAAAGG - Intergenic
937256753 2:120561159-120561181 GCGGGATGGTGGAGGAGCCAAGG + Intergenic
937687987 2:124720124-124720146 CTGGGATGATGGAGGGACCAAGG - Intronic
937825555 2:126365148-126365170 CCAGGTTGATGGTGGTGACTGGG + Intergenic
940369008 2:152879279-152879301 CTGGGAAGTTGGAAGTGACAGGG + Intergenic
942105551 2:172629840-172629862 CGGGGAGCATGCAGGTGACAGGG - Intergenic
947369315 2:229428296-229428318 CTGGGATGAGAGTGGTGACAGGG + Intronic
947731333 2:232433180-232433202 GCAGGATGATGGTAGTGACAAGG + Intergenic
948415523 2:237799869-237799891 CAGGGATAAGGGAGGTGTCAAGG + Intronic
1171022123 20:21595152-21595174 TGGGGGTGAGGGAGGTGACAAGG - Intergenic
1172474117 20:35224796-35224818 CTGGCTTGAAGGAGGTGACAAGG - Intergenic
1173170687 20:40721090-40721112 CAGACATGATGGAAGTGACAAGG + Intergenic
1173461410 20:43246263-43246285 TCAGGATGAGGGAGGTGAGAGGG + Intergenic
1173480244 20:43392952-43392974 GGGGGATGATGGAGGTGAGAAGG + Intergenic
1174136333 20:48382628-48382650 GTGGGATCAGGGAGGTGACAGGG + Intergenic
1175812489 20:61866021-61866043 CCAGGATGCTGGTGGTGACAGGG - Intronic
1175841123 20:62028145-62028167 CTGGGATGCTGGAGGTGCTAAGG + Intronic
1176350746 21:5794184-5794206 GGGTGATGATGGGGGTGACAGGG + Intergenic
1176357560 21:5914768-5914790 GGGTGATGATGGGGGTGACAGGG + Intergenic
1176545067 21:8192254-8192276 GGGTGATGATGGGGGTGACAGGG + Intergenic
1176564018 21:8375299-8375321 GGGTGATGATGGGGGTGACAGGG + Intergenic
1178691357 21:34752732-34752754 GCGGGAGGATGGGGGTGGCAAGG - Intergenic
1180065914 21:45412310-45412332 CCCGGAAGATGGAGGTTGCAGGG - Intronic
1184214166 22:43055405-43055427 CCTGGAAGATGGAGGCTACAGGG - Intronic
1184231146 22:43159133-43159155 CGGGGATGCTGGAGGAGACACGG + Intronic
1184511532 22:44936221-44936243 CAGGGCTCATGCAGGTGACAAGG - Intronic
1184687170 22:46101900-46101922 CCGTGATGAGGGATGGGACAGGG + Intronic
1184806165 22:46796173-46796195 CGGGGATGGGGGAGGAGACAGGG + Intronic
1184846263 22:47089622-47089644 GTGGGAAGCTGGAGGTGACAAGG + Intronic
1185009975 22:48307397-48307419 CCGGTACGATGCAGGTGACAAGG - Intergenic
1203249937 22_KI270733v1_random:108492-108514 GGGTGATGATGGGGGTGACAGGG + Intergenic
950298135 3:11849721-11849743 CCCGGATGGTGGAGGTTGCAGGG - Intergenic
950519966 3:13492265-13492287 CTGGGATGATGCAGGTGAGGTGG + Intronic
951810050 3:26688813-26688835 CAGGGATTATGGGGGTGAGATGG - Intronic
952251080 3:31655164-31655186 GCAGCATGATGGAGGAGACAAGG + Intergenic
954381420 3:50221077-50221099 CTGGGATGAGGGTGGGGACAGGG + Intergenic
954638810 3:52085920-52085942 CCGGGATGTTGGGGGAGCCATGG + Intronic
959612876 3:108314575-108314597 CGGGGAGGTTGCAGGTGACATGG - Intronic
960959816 3:123062346-123062368 CCGAGATGATGGAGGGGAACTGG + Intergenic
961667502 3:128502878-128502900 CTGGGATGATGGTGGAGACCTGG + Intergenic
966364010 3:179162745-179162767 CTTGGATGTTGGAGGTTACAGGG + Intronic
968337248 3:197924331-197924353 CCTGGGTGATGGAGTGGACAGGG + Intronic
968513833 4:1007673-1007695 TCAAGATGCTGGAGGTGACAGGG - Intergenic
968513840 4:1007747-1007769 TCAAGATGCTGGAGGTGACAGGG - Intergenic
968513847 4:1007821-1007843 TCAAGATGCTGGAGGTGACAGGG - Intergenic
968890679 4:3366986-3367008 CAGGGATGATGGGGGTGGCGGGG - Intronic
971540419 4:27809452-27809474 ACTGGAAGATGGAGGTGAAATGG + Intergenic
975431407 4:74295709-74295731 CAGAGTTGAAGGAGGTGACATGG - Intronic
975840121 4:78464957-78464979 TCCGGATGAAGGAGGTGAAAGGG - Intronic
976562725 4:86520998-86521020 CCGGTCTGGTGGAGGTGGCAAGG + Intronic
979727589 4:123982762-123982784 CCGGGAAGAATCAGGTGACATGG + Intergenic
981014672 4:139961467-139961489 CCAGGATGATGGAATTGACTGGG - Intronic
982979569 4:162115592-162115614 CTGTGAAGATGGAGGTTACAAGG - Intronic
985520191 5:370595-370617 CCAGGAAGATGCAGGTGACAGGG + Intronic
986190767 5:5494628-5494650 CCGGGCAGATGGAGGTCTCAGGG + Intergenic
987204276 5:15609194-15609216 CCAGGATGATGCAGGTGAAATGG - Intronic
988442810 5:31251041-31251063 CCTAGATGGTGGAGGTGAGAAGG - Intronic
989114290 5:37937371-37937393 CATGGTTGATGGAGGTTACAGGG + Intergenic
992327115 5:75671134-75671156 CTATGATGATGGTGGTGACAGGG + Exonic
992504708 5:77375573-77375595 CCTGGCTGATGGAGGGGAGATGG - Intronic
996412372 5:123172202-123172224 CAGGGAGGATGGAGGTGGCGGGG + Intronic
997555969 5:134799041-134799063 CCGGGAGGATGTAGGTAATATGG + Intronic
1001535937 5:172497869-172497891 CAGAGATGAGGGGGGTGACAGGG - Intergenic
1002508783 5:179699089-179699111 CCGGGAGGCTAGAGGTGAGAGGG + Exonic
1002820587 6:720738-720760 CCAGGAGGACGGTGGTGACATGG + Intergenic
1003146565 6:3514958-3514980 CAGGGATGATGGAGGGGAATTGG + Intergenic
1003245393 6:4378272-4378294 CAGGGAAGATGGAGGGGACAGGG + Intergenic
1005968707 6:30744443-30744465 CCGGGATGGTGGAGGGGGCCGGG + Exonic
1006373055 6:33657208-33657230 CCAGTCTGATGGAGGGGACAGGG + Intronic
1007339927 6:41184920-41184942 CCAGGATGATGGACTTGACTGGG + Intergenic
1007618462 6:43196622-43196644 CTGGGAGGAGGGAGGTGACCAGG - Intronic
1009705730 6:67248890-67248912 CAGGTATGATGAAGATGACAGGG + Intergenic
1009763315 6:68036887-68036909 CCCGGGTGATGGAGGTTGCAAGG - Intergenic
1011788126 6:90868773-90868795 CAGGGATGGTGGAGGTGAGGAGG + Intergenic
1012414440 6:98997541-98997563 GAGGGATGTTGGTGGTGACAGGG + Intergenic
1013316592 6:108948990-108949012 CCAGGTAGATGGAGGTGAAACGG + Intronic
1015711775 6:136149365-136149387 CTGGGATGATCAAGGTCACAAGG - Intronic
1018301836 6:162410878-162410900 CAGGGAAGAAGGAGGTGACAGGG + Intronic
1018839888 6:167509127-167509149 ACAGGGGGATGGAGGTGACAGGG - Intergenic
1019195148 6:170276954-170276976 CCGGAGTGATGGAGGGGAAAGGG - Intergenic
1019833291 7:3355588-3355610 CCGTGAAGATGGAGGGAACAGGG - Intronic
1021484158 7:21148562-21148584 CCGGGAAGATGGAGGTCGCAAGG - Intergenic
1021584587 7:22194047-22194069 CAGGGATGATGGATGAGAGAAGG + Intronic
1024043556 7:45573312-45573334 CCGGGATAACGGAGGAGGCAGGG + Intergenic
1026472130 7:70702707-70702729 CCAGGCTGATGGAGGTGAGGTGG - Intronic
1027421968 7:78025670-78025692 GAGGGATGATGGTGGTGAAATGG + Intronic
1029104209 7:98161966-98161988 CCCGGCTGATGGAGGTGGCTTGG + Intronic
1029538106 7:101167478-101167500 CTGGGAAGATGAAGGGGACATGG - Intergenic
1031084580 7:117289907-117289929 CCGGGATGATGGAGGTGACAAGG + Intronic
1031280055 7:119787835-119787857 GAGGGATGGTGGAGGGGACACGG + Intergenic
1033327566 7:140392214-140392236 CTGGGCTGGTGGAGGTTACACGG - Intronic
1033842155 7:145387318-145387340 CTGGGAAGAGGGAGGTGATAGGG - Intergenic
1035072776 7:156157282-156157304 CCGGGCGGCTGGAGGTGCCAGGG - Intergenic
1035153708 7:156895267-156895289 CTGGGGTGATGGAGGTGACCAGG - Intergenic
1035623575 8:1053455-1053477 CTGGGATGACGGAGCTGACTGGG - Intergenic
1037689287 8:21169315-21169337 CCGTGATGATGTTGATGACAAGG - Intergenic
1039439001 8:37581670-37581692 CGGGGATGGGGGAGGTGACAGGG + Intergenic
1039971759 8:42326452-42326474 CCGGGAGGAGGGTGGTGACTCGG - Intronic
1042225747 8:66513159-66513181 CAGTGATGATGGAGGTGTGAGGG + Intronic
1045318431 8:101063168-101063190 CAGGAATGTTGGAGGTGGCATGG + Intergenic
1046309268 8:112413937-112413959 GGGGGATGGTGGAGGTGAGAGGG - Intronic
1048496879 8:134942751-134942773 CAGTGGTGATGGAGATGACATGG + Intergenic
1049221456 8:141430579-141430601 CCTGGATGGTGGAGGTGCCCAGG + Intronic
1049267864 8:141678943-141678965 CTGGCAAAATGGAGGTGACAAGG - Intergenic
1053131744 9:35619246-35619268 CCTGGCTGATGGAGGAGAGAGGG + Intronic
1054743019 9:68827600-68827622 CAGGGTTGAGGGAGATGACACGG + Intronic
1058914480 9:109552414-109552436 CAGGGAATTTGGAGGTGACAGGG - Intergenic
1060204240 9:121673240-121673262 CAGAGAAGATGGAGGGGACATGG - Intronic
1061753463 9:132796886-132796908 CCAGGGTGGTGGAGGTGAGAGGG + Intronic
1062321509 9:135992648-135992670 CTGGGATGCTGGAAGTGTCAGGG - Intergenic
1062415791 9:136448844-136448866 CCAGGAGGATGGAGGTGGGAGGG + Intronic
1062516514 9:136939719-136939741 CCGGGGCGATGGTGGTGACAAGG - Intronic
1203466333 Un_GL000220v1:91753-91775 GGGTGATGATGGGGGTGACAGGG + Intergenic
1185444872 X:252557-252579 CCTGGATGTTGGTGGGGACAAGG + Intergenic
1186888516 X:13938355-13938377 CCGGGACGCTGGAGGTGGGAGGG - Intronic
1187255421 X:17637394-17637416 CGGGGGTGGTGGTGGTGACAGGG + Intronic
1187255898 X:17641825-17641847 GTGGGATGGAGGAGGTGACAAGG + Intronic
1190897399 X:54634375-54634397 CCCGGGAGATGGAGGTGGCAGGG - Intergenic
1191779973 X:64854459-64854481 CAGGGGTGAAGGAGGTGGCAGGG - Intergenic
1192021969 X:67403329-67403351 CTGGTTTGATGGAGGTGGCAGGG + Intergenic
1193198191 X:78658058-78658080 CCGGGTTGCTGGAGGCGCCAGGG + Exonic
1194282867 X:91974616-91974638 CAGGGAAGATGGTGGTGGCAAGG + Intronic
1199642010 X:149871507-149871529 CTGGGATGCTGTAGGAGACATGG - Intergenic
1200072815 X:153537415-153537437 GCGGGAGGCTGGAGGTGCCAAGG - Intronic
1200075878 X:153550454-153550476 CCGGGTTGATGGAGGTGTTTTGG - Intronic
1200600445 Y:5199150-5199172 CAGGGAAGATGGTGGTGGCAAGG + Intronic
1200945070 Y:8826804-8826826 CTGGGATGATAGAGGGGAGAGGG + Intergenic