ID: 1031084678

View in Genome Browser
Species Human (GRCh38)
Location 7:117290825-117290847
Sequence CCAGTGATTATAAGAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 251}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031084673_1031084678 21 Left 1031084673 7:117290781-117290803 CCACGAGGATAAGGACTGAGTCT 0: 1
1: 0
2: 3
3: 43
4: 228
Right 1031084678 7:117290825-117290847 CCAGTGATTATAAGAGTGTCTGG 0: 1
1: 0
2: 0
3: 19
4: 251
1031084674_1031084678 -7 Left 1031084674 7:117290809-117290831 CCTCAATCCTGCGTTCCCAGTGA 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1031084678 7:117290825-117290847 CCAGTGATTATAAGAGTGTCTGG 0: 1
1: 0
2: 0
3: 19
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031084678 Original CRISPR CCAGTGATTATAAGAGTGTC TGG Intronic
901117173 1:6856508-6856530 CCAGTGACTAGAATAGTGCCTGG - Intronic
902280785 1:15372559-15372581 CCAGTGCCTAGAACAGTGTCCGG + Intronic
902314247 1:15605860-15605882 AAAGTGCTTAGAAGAGTGTCCGG + Intergenic
903481085 1:23653814-23653836 CCAGTGACTAGAACAGTGCCTGG + Intergenic
904074993 1:27834234-27834256 CCAATGATCAGAGGAGTGTCTGG - Intronic
905193720 1:36257355-36257377 CCAGTGTTTAGAATAGTGCCTGG + Intronic
905248225 1:36629341-36629363 CCAGAAATTATACTAGTGTCAGG + Intergenic
906061363 1:42951079-42951101 CCATTGACTAGAAGAGTGTTGGG - Intronic
906300688 1:44679426-44679448 CCACTGATCATTAGAGTCTCTGG + Intronic
911494597 1:98615708-98615730 ACAGAGATTGTAAGTGTGTCAGG - Intergenic
912170782 1:107096887-107096909 TCAGTGTTTAGCAGAGTGTCAGG - Intergenic
913224421 1:116686443-116686465 CCAGTGCTTCTCAGAGTGTGGGG + Intergenic
916014017 1:160732526-160732548 CCAGTAACTAGAAGAGTGCCTGG - Intergenic
916153818 1:161824592-161824614 CCAGTGCTTAGAACAGTGGCTGG + Intronic
916600684 1:166290567-166290589 TCAGTGAGTATAAGAGTTTGAGG - Intergenic
917678609 1:177343500-177343522 CCAGTGTTTAAAATACTGTCTGG + Intergenic
919721219 1:200838537-200838559 TCAGTGTTTAAAACAGTGTCTGG - Intronic
920869957 1:209785742-209785764 CCAGTCCTTAGAACAGTGTCTGG - Exonic
921189595 1:212698410-212698432 CCAGTGTCTAGAACAGTGTCTGG - Intronic
1063542862 10:6951876-6951898 CAAGTGCTCATTAGAGTGTCTGG - Intergenic
1063627534 10:7704536-7704558 CCAGTGATTAGGTGGGTGTCTGG - Intronic
1063628811 10:7715516-7715538 CCAGTGCCTAGAAGAGTTTCTGG - Intronic
1067153636 10:43756685-43756707 CAAGTGCTTTGAAGAGTGTCTGG - Intergenic
1069281404 10:66659078-66659100 CCAGTTCTTAGAAGAGTTTCAGG - Intronic
1070234885 10:74613294-74613316 CCAGTGATTCTCAAAGTGACAGG - Intronic
1070914139 10:80142009-80142031 CCAGTGTTTACAGGAGTCTCTGG + Intronic
1071415298 10:85435749-85435771 CCAGAGAAGATAAAAGTGTCTGG + Intergenic
1071810812 10:89178881-89178903 CTAGTGTTTAGAACAGTGTCTGG + Intergenic
1073919647 10:108444066-108444088 GCAGTGCTTTTAAGAGAGTCTGG - Intergenic
1075114640 10:119615714-119615736 CCAGTCATTTTAAGAGTGTGGGG + Intergenic
1076147934 10:128139895-128139917 CCTGTGATTTTAAAAGTGTGAGG - Intergenic
1076559945 10:131355719-131355741 CCAGTGATTTTAACACTGGCTGG - Intergenic
1077817945 11:5706308-5706330 CCAGGGATAGTAAGAGTGTGGGG + Intronic
1078598506 11:12710627-12710649 CCAGTGCCTACAACAGTGTCTGG - Intronic
1080236079 11:30069877-30069899 CCAGTGTCTAGAACAGTGTCTGG + Intergenic
1083449727 11:62735226-62735248 CCAGTGTGTAGAAGAGTGTCTGG + Intronic
1086699606 11:89885522-89885544 CCAGCGATTATCAAATTGTCTGG - Intergenic
1086706565 11:89958992-89959014 CCAGCGATTATCAAATTGTCTGG + Intergenic
1087489012 11:98799457-98799479 CCACTCATAATAAAAGTGTCAGG - Intergenic
1088064720 11:105702620-105702642 AAAGTGCTTAAAAGAGTGTCTGG - Intronic
1089166431 11:116480936-116480958 CCAGTGCTTAGATCAGTGTCTGG - Intergenic
1090309595 11:125723336-125723358 AGAGTGCTTAGAAGAGTGTCTGG + Intergenic
1091546667 12:1505621-1505643 CCTGTGCTTAGGAGAGTGTCTGG + Intergenic
1092395951 12:8126695-8126717 CCAGTGGTTATAACATTGTATGG + Intronic
1094091020 12:26649993-26650015 CCAGTGACTAGAACTGTGTCTGG + Intronic
1094440304 12:30468442-30468464 CCAGTGCTTGTAAGGGTGTAGGG + Intergenic
1095320753 12:40822904-40822926 CCAGAGAATATAAGAGGGACAGG - Intronic
1098120216 12:67228637-67228659 CTATTGATTATAATAGTTTCAGG + Intergenic
1098731582 12:74042012-74042034 CAAGTGCTTAAAACAGTGTCTGG - Intergenic
1099569859 12:84303462-84303484 TCAGTGTTTAGCAGAGTGTCTGG - Intergenic
1100073101 12:90745812-90745834 CCAGTGCCTATCAGAGTGACTGG - Intergenic
1100118509 12:91340127-91340149 CCAATGTTTAGAACAGTGTCTGG - Intergenic
1100543373 12:95578881-95578903 CCAGTGATCAGCACAGTGTCTGG + Intergenic
1101598403 12:106188113-106188135 ACAGTGATTAAAACAGTGGCTGG + Intergenic
1101621869 12:106396463-106396485 CCAGTGATTAGTACAGTGTTTGG - Intronic
1101697058 12:107136560-107136582 CCAGTGCCTAAAACAGTGTCTGG - Intergenic
1103090080 12:118091611-118091633 CCAGTGCCTAGAACAGTGTCTGG + Intronic
1107222327 13:37998713-37998735 CCAAAAATTATAGGAGTGTCTGG + Intergenic
1108857684 13:54815200-54815222 CCAGTGCCTATAACAGTGCCAGG - Intergenic
1109763225 13:66858848-66858870 ACAGTGCTTAGAAGAATGTCTGG + Intronic
1110439701 13:75514001-75514023 CAAGTGATTAGCAAAGTGTCTGG + Intergenic
1111417373 13:87967092-87967114 CCAGTGTATAGAATAGTGTCTGG - Intergenic
1111648320 13:91059928-91059950 CCAGTCAAAATAAGATTGTCAGG + Intergenic
1111671107 13:91331675-91331697 CCAGTAATCATAACAGTGTCTGG - Intergenic
1111702640 13:91710164-91710186 CCAGTGATTGTTAAAGTGTCTGG + Intronic
1116114056 14:40625464-40625486 ACAGTGATGATAATAGTGGCAGG - Intergenic
1119512780 14:75224622-75224644 CCAATGCCTAGAAGAGTGTCTGG + Intergenic
1119722560 14:76901086-76901108 CCAGTGAAAATAACAGTGGCTGG - Intergenic
1119760245 14:77145781-77145803 CAAGTGCCTATAACAGTGTCTGG + Intronic
1121885600 14:97539934-97539956 CAAGTGATTAGAAGAGTGCCTGG + Intergenic
1122132728 14:99614493-99614515 CCGGTGATTCTAAGGGTGGCTGG - Intergenic
1123021751 14:105401168-105401190 CCAGTGCTTAGGACAGTGTCTGG + Intronic
1124943247 15:34238136-34238158 CCTCTGATTATAATAGTGTTGGG - Intronic
1128106670 15:65050349-65050371 CCAGTGCTGAGAACAGTGTCTGG - Intronic
1129084678 15:73076467-73076489 CCAGTGCCTAGAAGAGTGCCAGG + Intronic
1130132759 15:81158146-81158168 AGAGTGCTTAGAAGAGTGTCTGG + Intergenic
1131222426 15:90596124-90596146 CCAGTGCTTAGAACAGTGCCTGG - Intronic
1131606209 15:93905647-93905669 CCAGTGCCTATAAAAGTGCCTGG - Intergenic
1134927027 16:18173240-18173262 CCAATGATTAGAAGAATGCCTGG - Intergenic
1135894225 16:26384067-26384089 CAAGTGCTTAGAAAAGTGTCTGG - Intergenic
1137069025 16:35882512-35882534 CCAGCAATTATAATAGTTTCAGG - Intergenic
1137317705 16:47344984-47345006 CCAGTGTTTAGAATAGTGGCTGG - Intronic
1137774236 16:51042222-51042244 CCAGTGACTGAAAGAGTGCCTGG - Intergenic
1138273338 16:55711989-55712011 CCCGTGACTATAAGAGAGTCTGG + Intergenic
1138322974 16:56134618-56134640 CCTGTGTCTAGAAGAGTGTCTGG + Intergenic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1138821798 16:60269406-60269428 CCAGTGATTAAAAGAAGCTCTGG - Intergenic
1139255708 16:65540087-65540109 ACAGTGATTAGAACAGTGGCTGG - Intergenic
1139280043 16:65762812-65762834 CCAGTGCCTATATCAGTGTCTGG - Intergenic
1140664297 16:77213617-77213639 CCAGTGCTTAGAACAGTGCCTGG - Intergenic
1146088028 17:29848374-29848396 CCAGTGATTATAACACTATTTGG + Intronic
1150735881 17:67738779-67738801 CCAATGATTAGGAGAGTGTTTGG + Intronic
1155709260 18:28855621-28855643 CCAGAGCTTAGAAGAGTGCCTGG + Intergenic
1155736188 18:29225167-29225189 CCAGTATTTACAAGAGTGCCTGG + Intergenic
1156015119 18:32538616-32538638 CCAGTGCTTAGTAGAGTGTCTGG + Intergenic
1157528360 18:48402103-48402125 CCAGGGCTTAGAGGAGTGTCCGG - Intronic
1158273789 18:55744801-55744823 CCAATGATTATAAGAATACCAGG - Intergenic
1158903259 18:61986167-61986189 GAAGTGCTTATAATAGTGTCTGG + Intergenic
1160393559 18:78555890-78555912 CCAGTGATGTTAGGAGAGTCTGG + Intergenic
1166079024 19:40432038-40432060 TCAGTGCCTATAACAGTGTCTGG - Intergenic
1167128596 19:47569303-47569325 CAAGTGATTACAAGAGTACCTGG - Intergenic
1167574422 19:50311122-50311144 CCAGTGCCTAGAACAGTGTCTGG + Intergenic
926186939 2:10697962-10697984 CCAGTGATTAGGAGAGGCTCTGG + Intergenic
926512524 2:13800283-13800305 CCAGGGATTGAAAGAGAGTCTGG + Intergenic
927522841 2:23710966-23710988 CCAGTGCTTAGCACAGTGTCGGG - Intergenic
929539133 2:42806489-42806511 CCAGTGTTGATGAGAGTGTGGGG - Intergenic
930236848 2:48896743-48896765 CCAGTGCTTATAACAGTGTTTGG + Intergenic
931216858 2:60253300-60253322 CAAGTGATTAGAACAGTGCCTGG - Intergenic
932221755 2:70004922-70004944 CCAGTGTTTAGAATAGTGCCTGG + Intergenic
932689746 2:73902183-73902205 CCAGTGAGTATGAAGGTGTCAGG - Intronic
932787263 2:74617694-74617716 CCATTTGTTTTAAGAGTGTCTGG + Intronic
933139601 2:78777603-78777625 CCAGTGCTTAGAACAGTGTCTGG - Intergenic
934580024 2:95430406-95430428 CCAGTGCCTAGAACAGTGTCTGG - Intergenic
934586526 2:95503472-95503494 CCAGGGATTATCAAAGCGTCAGG + Intergenic
934599423 2:95646319-95646341 CCAGTGCCTAGAACAGTGTCTGG + Intergenic
936532768 2:113288328-113288350 CCAGTGCCTAGAACAGTGTCTGG + Intergenic
938921799 2:136002011-136002033 CCAGTGTTCAGAAGAGTGCCTGG + Intergenic
939045795 2:137248365-137248387 CCAGTGCTTAGTACAGTGTCTGG + Intronic
939429839 2:142089072-142089094 CCAGTGCCTAGAAGGGTGTCTGG - Intronic
941021474 2:160411278-160411300 CCAGCAACTATAAGAGTGCCAGG + Intronic
941132428 2:161670107-161670129 CAAGTGCTTATAATGGTGTCTGG + Intronic
941936915 2:170989198-170989220 CAAGTGATGATTAGATTGTCTGG - Intergenic
942037089 2:172020587-172020609 CCAATGACTAGAACAGTGTCTGG - Intronic
943065020 2:183076583-183076605 CCAATGACTATAACAGTGCCAGG + Intergenic
944662461 2:201932609-201932631 CAAGTGCTTAGAAGAGTGTCTGG + Intergenic
944937685 2:204586221-204586243 CAATTAATTAAAAGAGTGTCAGG - Intronic
944966707 2:204943502-204943524 CCAGTGGTTATATGTGTGCCAGG + Intronic
946377854 2:219324574-219324596 CCAGGGCCTAGAAGAGTGTCTGG + Intergenic
1168975649 20:1963724-1963746 CCAGTGCTTATAACTGTATCTGG + Intergenic
1168990506 20:2091442-2091464 GAAGTGTTTATAACAGTGTCTGG + Intergenic
1169317833 20:4608128-4608150 CAAGTGCTTAGAACAGTGTCTGG + Intergenic
1170741558 20:19063026-19063048 ACAGTGATTTTCAGAGTTTCAGG + Intergenic
1173442996 20:43094794-43094816 CCAGCATTTAGAAGAGTGTCTGG + Intronic
1174718442 20:52785163-52785185 CAAGTGCTTAAAACAGTGTCTGG + Intergenic
1174819030 20:53711557-53711579 CCAGTGACTAAAACAGTGCCTGG + Intergenic
1174959817 20:55143004-55143026 CCAGTGCTTAGAAGAATCTCTGG + Intergenic
1177863980 21:26490857-26490879 CTAGTGCTTAGTAGAGTGTCTGG - Intronic
1178478808 21:32961323-32961345 TCAGTGACTAGAACAGTGTCTGG + Intergenic
1179390339 21:40983108-40983130 CCAGAGATTTTAAGACTGTTGGG + Intergenic
1183573156 22:38669424-38669446 CCAGTGCTTAGGAGAGTGCCTGG - Intronic
949789467 3:7777285-7777307 CCAGTGCCTAAAACAGTGTCTGG - Intergenic
950536737 3:13583245-13583267 CCAGTGATTAACACAGTGCCTGG - Intronic
950784168 3:15419392-15419414 CCAGTGCTTAGAACAGTGACTGG + Intronic
952111475 3:30128785-30128807 CCAGTATTTATAACAGTGTCTGG - Intergenic
952360765 3:32627973-32627995 CCAGAGATTCTAAGAGTTTTGGG + Intergenic
952712107 3:36442123-36442145 CCATTGATCATAAGAGAGACTGG + Intronic
955577552 3:60382574-60382596 ACAGTGATTTTCAGAGTATCAGG - Intronic
955758340 3:62250065-62250087 CAAGTACTTATAAGAGTGCCTGG - Intronic
955758342 3:62250144-62250166 CAAGTACTTATAAGAGTGCCTGG - Intronic
957402901 3:79739731-79739753 CCAGTGCTTTGAAGAGTGGCTGG - Intronic
958478664 3:94618689-94618711 CCAGTGAGAATAAAAGTCTCAGG + Intergenic
959585413 3:108021113-108021135 CCAATGATTATCATAGTATCTGG - Intergenic
960255722 3:115509189-115509211 CCAGTGCTTTAAAGAGTGCCTGG - Intergenic
960803373 3:121560453-121560475 ACAGGGTTTAGAAGAGTGTCTGG - Intergenic
961060421 3:123823819-123823841 CCAGTGAGTGTAAGAGTGGGAGG - Intronic
962041302 3:131710060-131710082 GCAGTGCCTACAAGAGTGTCTGG + Intronic
962529136 3:136262755-136262777 GCAGGGATGATAAGAGTGGCTGG - Intronic
962696941 3:137958864-137958886 CCAGTGACTAGAAGAGGGCCTGG + Intergenic
963085631 3:141433386-141433408 CCAATGACTGTAAGAGTGTAAGG - Intronic
963572046 3:147009531-147009553 TGAGTGATTAGATGAGTGTCTGG - Intergenic
963905451 3:150770136-150770158 CATGTGCTTAAAAGAGTGTCTGG - Intergenic
964441508 3:156716208-156716230 ACAGTGCTTAGAATAGTGTCTGG - Intergenic
965826134 3:172732079-172732101 CCAGTGATTAACATAGTGCCTGG + Intergenic
967416368 3:189223119-189223141 CCAGTGATTAGTACAGTGTGTGG + Intronic
967670069 3:192222609-192222631 TCAAAGATAATAAGAGTGTCTGG + Intronic
968897091 4:3410772-3410794 CCAGTGAACCTACGAGTGTCCGG + Intronic
970761126 4:19488883-19488905 CCAGTGCTTAGAAGAATGTCTGG + Intergenic
971230527 4:24797443-24797465 ACAGTACTTATAATAGTGTCTGG + Intronic
972101377 4:35423250-35423272 CCAGTATTTAGAAGAGTGCCTGG - Intergenic
972731820 4:41802227-41802249 CCAGTGTTCAAAACAGTGTCTGG + Intergenic
975873142 4:78804133-78804155 CTAGTGATTACAAGAGTTTGGGG - Intronic
976327485 4:83788550-83788572 CCAGTGATTATCACAGTACCTGG + Intergenic
976570433 4:86601899-86601921 CCAGTGCCTAGTAGAGTGTCTGG - Intronic
976968031 4:91069514-91069536 CCAGTACTTAGAACAGTGTCTGG - Intronic
978398159 4:108304426-108304448 CCAGTGATTCTCACAGTGTGGGG - Intergenic
980015869 4:127649768-127649790 CTAGTGCTTAGAAGAGTGCCTGG + Intronic
981179595 4:141724765-141724787 TTAGTGATTATATGAGTGTTTGG - Intronic
981337203 4:143581162-143581184 CCAGTGAGGATAACAGTGGCAGG - Intronic
983554966 4:169051764-169051786 CCAGTGCCTAGAAGAGTGTGTGG - Intergenic
983856680 4:172655426-172655448 ACAGGGCTTATAATAGTGTCTGG - Intronic
983861319 4:172710939-172710961 CCAGTACCTATAAGAGTGCCTGG - Intronic
984000192 4:174231537-174231559 CCAGTGCTTAGCATAGTGTCTGG + Intergenic
985439723 4:189972006-189972028 CCATTTATTATAAGAGTTTTTGG + Intergenic
989394555 5:40940201-40940223 ACAGGGATTATAAGAGAGACTGG - Intronic
989550147 5:42725593-42725615 AAAGTGCTTAGAAGAGTGTCTGG - Intergenic
990099604 5:52165527-52165549 CCAGTAACTAGAAGAGTGTCTGG - Intergenic
991272799 5:64805319-64805341 ACAGTGATTACTTGAGTGTCAGG - Intronic
995781294 5:115778217-115778239 CCAGTGATTAACAATGTGTCTGG + Intergenic
996294150 5:121891182-121891204 CCAGTGATTGTAACAGAGGCAGG - Intergenic
999544321 5:152610131-152610153 CCAGTGACTGAAACAGTGTCTGG - Intergenic
999866881 5:155710524-155710546 CCAGTGCTTAATATAGTGTCTGG - Intergenic
1000006227 5:157187319-157187341 CCAGTGTCTACAAGAGTGTCTGG + Intronic
1000491445 5:161919437-161919459 CCAGTGCTTAAGACAGTGTCTGG - Intergenic
1001563510 5:172685213-172685235 CCACTGATTAAACCAGTGTCAGG - Intronic
1001718750 5:173839339-173839361 CCAGTGTTTATATGCGTGTGGGG + Intergenic
1002136285 5:177109849-177109871 CCAGTGACTAGAAGAGTACCTGG - Intergenic
1002985326 6:2184963-2184985 CCAGTGCCTAAAACAGTGTCTGG - Intronic
1003960986 6:11209249-11209271 CCAGTGCCTATAAGAATGTTTGG - Intronic
1004329693 6:14710260-14710282 CCAGACTTTATAACAGTGTCTGG - Intergenic
1004601391 6:17153791-17153813 CCAGGGGTTATATGAGTGCCTGG - Intergenic
1005172632 6:23005540-23005562 ACAGTGATTATAAGAATGCCAGG + Intergenic
1005345087 6:24881434-24881456 CCATTGGTTATAGGAGTGGCAGG - Intronic
1005404095 6:25467018-25467040 CCAGTGCTTATGAGAATGTGTGG + Intronic
1007382837 6:41501943-41501965 CCAGTGCCTAGAACAGTGTCTGG + Intergenic
1010747895 6:79584765-79584787 CCAGTGTTGATGAGAGTGTGGGG + Intergenic
1010863986 6:80949826-80949848 CCAATGATTAGAATAGTGACTGG - Intergenic
1010937641 6:81880829-81880851 AAAGTGATTAAAACAGTGTCTGG + Intergenic
1011305540 6:85922293-85922315 CCAGGGACTATTAGAGTTTCTGG + Intergenic
1011355330 6:86467457-86467479 CCACTGACTAAAAGAGTGCCTGG - Intergenic
1011599837 6:89049677-89049699 CCAGTGTTTGGAAGAGTGTATGG + Intergenic
1012454938 6:99393454-99393476 CCAGTGCTCATACCAGTGTCTGG + Intronic
1014287007 6:119511258-119511280 ACAGTGATTGGAAGAGTGCCAGG - Intergenic
1015909582 6:138155694-138155716 CCAGTGAGCAGAAGAGTGACTGG - Intergenic
1020964272 7:14845596-14845618 CCAGTGCTTAGAAGAGTGCTTGG + Intronic
1021562915 7:21986738-21986760 CCAGTGTTTAGAAGAGTATTTGG + Intergenic
1021819593 7:24483351-24483373 CTAGTGATTTTAAGTGTGCCTGG + Intergenic
1021944630 7:25714612-25714634 CCAGTCTTCAGAAGAGTGTCTGG + Intergenic
1022003672 7:26248137-26248159 CCAGCTATTATAGGATTGTCTGG - Intergenic
1022130468 7:27400338-27400360 CTAGCGATAATAAGTGTGTCTGG - Intergenic
1022427443 7:30282974-30282996 CCAGTGTTTAACACAGTGTCTGG - Intergenic
1024414749 7:49093373-49093395 GCAGTGCTTAAAATAGTGTCTGG - Intergenic
1026500024 7:70936181-70936203 CCAGTGCTTAGAACAGTGCCCGG - Intergenic
1028531609 7:91844580-91844602 CTAGTGACTATCACAGTGTCTGG - Intronic
1028974611 7:96897841-96897863 CCAGTGATTACAGAAGTCTCAGG - Intergenic
1031084678 7:117290825-117290847 CCAGTGATTATAAGAGTGTCTGG + Intronic
1032615374 7:133463435-133463457 CCATTGCTTGTAAGAATGTCTGG - Intronic
1034298854 7:149997479-149997501 CAAGTGCTTAAGAGAGTGTCTGG + Intergenic
1034729619 7:153375028-153375050 CCAGTGCTTATTATAGTGTCTGG + Intergenic
1034807163 7:154099302-154099324 CAAGTGCTTAAGAGAGTGTCTGG - Intronic
1036185094 8:6615709-6615731 CCACTAATTATAAGATTGTAGGG + Intronic
1037503762 8:19510252-19510274 CCAGAGATTGTAAGAATGGCAGG - Intronic
1040893893 8:52345527-52345549 CCAGTGAGTCTAAGAGTGATGGG + Intronic
1041862492 8:62530428-62530450 CCAGTGAGTATCACTGTGTCTGG - Intronic
1041992805 8:64014446-64014468 TCAGTGCTTATAAGATTGCCTGG - Intergenic
1042381635 8:68121730-68121752 CCAGTGATTAGAACAGTGGTTGG + Intronic
1044506725 8:93029001-93029023 CCAGGGACTATAACAGTGCCTGG + Intergenic
1044808323 8:96031540-96031562 CCAGTGGTTACAACAGTGCCTGG + Intergenic
1045169592 8:99649741-99649763 CCTGTGGTTTTAAGAGTGTAGGG - Intronic
1045638149 8:104216818-104216840 CCAGTGACTAGAATAGTGCCTGG + Intronic
1045690579 8:104756017-104756039 TAAGTGATTATCAGAGTGCCTGG + Intronic
1047318746 8:123758843-123758865 CAAGTGCTTAGAAGAGAGTCTGG - Intergenic
1048235634 8:132687327-132687349 CAAGTGCTTAGAAGAGTGCCTGG - Intronic
1050286223 9:4104870-4104892 CCAGTGCTTAGAAGAGAGACTGG + Intronic
1051435448 9:17026162-17026184 CCAGTGGTTAGAACAGTGCCTGG + Intergenic
1052668291 9:31522349-31522371 CCAGTGCTTACAATAGTGTCTGG - Intergenic
1053042654 9:34887862-34887884 CCAGTGCCTATAAAAGTGCCTGG + Intergenic
1053196023 9:36119643-36119665 CCAGTGCTTAGAGGAGCGTCTGG - Intronic
1053340560 9:37323855-37323877 CCAGTGATTACCAAAGTATCGGG + Intronic
1055231239 9:74068335-74068357 AAAGTGCTTATAATAGTGTCTGG - Intergenic
1058775078 9:108274856-108274878 CCAGTGACTAGAACAGTGTCCGG + Intergenic
1058777392 9:108297760-108297782 CCAGTTATTCTAAAAATGTCTGG + Intergenic
1060177574 9:121508297-121508319 CCAGTGCTTAGCACAGTGTCTGG + Intergenic
1060277696 9:122194296-122194318 CCAGTGCTTAGGGGAGTGTCTGG - Intronic
1061308450 9:129746404-129746426 CCAGTGCTTAGCACAGTGTCTGG + Intronic
1061415279 9:130444262-130444284 GCAGTGAGTAAAAGACTGTCTGG - Intergenic
1187241274 X:17515703-17515725 CCAGTGCTTAGAAGAGCATCTGG - Intronic
1188340410 X:28993963-28993985 CCAGTGATGAAAAGAGTACCTGG - Intronic
1188411529 X:29877966-29877988 ACAGTGTTTACAAGAGTATCTGG + Intronic
1188450944 X:30308084-30308106 TCAGTGATCAGGAGAGTGTCGGG - Intronic
1189136277 X:38553909-38553931 CCAGTGCTAAGAAAAGTGTCTGG + Intronic
1191079416 X:56493458-56493480 CCAGTGAATATAATAATGGCAGG - Intergenic
1194143150 X:90230230-90230252 CCAGTAATTATCAGAGTGCCTGG + Intergenic
1195990081 X:110673545-110673567 AAAGTGATTAGAATAGTGTCTGG - Intergenic
1197251034 X:124216744-124216766 CCAGTGATTCCCAGAATGTCTGG - Intronic
1197327359 X:125110097-125110119 AAAGTGCTTATAAGAGTGACTGG - Intergenic
1197555145 X:127944006-127944028 CCAGTGCTTAGAATAGTGCCTGG - Intergenic
1197737443 X:129862160-129862182 CCAGTGTTTAGAACAGTGACTGG + Intergenic
1197968618 X:132092095-132092117 CCAGTGCCTATAATAGTATCTGG + Intronic
1199843077 X:151670611-151670633 ACAGTGCTTAGAAGAGTGCCTGG + Intronic
1200488902 Y:3799551-3799573 CCACTAATTATCAGAGTGCCTGG + Intergenic
1200754540 Y:6977777-6977799 CCAGTATTTATATGAGTGTTGGG + Intronic