ID: 1031085498

View in Genome Browser
Species Human (GRCh38)
Location 7:117298158-117298180
Sequence GTGGCCAGTTAGAAGAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031085490_1031085498 25 Left 1031085490 7:117298110-117298132 CCCCACTGGCTATCAGTATAACA 0: 1
1: 0
2: 0
3: 10
4: 106
Right 1031085498 7:117298158-117298180 GTGGCCAGTTAGAAGAGTGAGGG No data
1031085492_1031085498 23 Left 1031085492 7:117298112-117298134 CCACTGGCTATCAGTATAACAGA 0: 1
1: 0
2: 0
3: 10
4: 84
Right 1031085498 7:117298158-117298180 GTGGCCAGTTAGAAGAGTGAGGG No data
1031085491_1031085498 24 Left 1031085491 7:117298111-117298133 CCCACTGGCTATCAGTATAACAG 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1031085498 7:117298158-117298180 GTGGCCAGTTAGAAGAGTGAGGG No data
1031085495_1031085498 -2 Left 1031085495 7:117298137-117298159 CCTCACAATTTAACAGGGCATGT 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1031085498 7:117298158-117298180 GTGGCCAGTTAGAAGAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031085498 Original CRISPR GTGGCCAGTTAGAAGAGTGA GGG Intronic
No off target data available for this crispr