ID: 1031089121

View in Genome Browser
Species Human (GRCh38)
Location 7:117332085-117332107
Sequence CACTTTTACTTCAACTAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031089121_1031089123 -8 Left 1031089121 7:117332085-117332107 CCTTGCTAGTTGAAGTAAAAGTG No data
Right 1031089123 7:117332100-117332122 TAAAAGTGGTAAAACCACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031089121 Original CRISPR CACTTTTACTTCAACTAGCA AGG (reversed) Intergenic
No off target data available for this crispr