ID: 1031089123

View in Genome Browser
Species Human (GRCh38)
Location 7:117332100-117332122
Sequence TAAAAGTGGTAAAACCACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031089119_1031089123 29 Left 1031089119 7:117332048-117332070 CCAACAGTTAAGATATGGAACAA No data
Right 1031089123 7:117332100-117332122 TAAAAGTGGTAAAACCACTTTGG No data
1031089121_1031089123 -8 Left 1031089121 7:117332085-117332107 CCTTGCTAGTTGAAGTAAAAGTG No data
Right 1031089123 7:117332100-117332122 TAAAAGTGGTAAAACCACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031089123 Original CRISPR TAAAAGTGGTAAAACCACTT TGG Intergenic
No off target data available for this crispr