ID: 1031092955

View in Genome Browser
Species Human (GRCh38)
Location 7:117384277-117384299
Sequence TTGCTCTTATATGTGTGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031092955_1031092957 -10 Left 1031092955 7:117384277-117384299 CCCTGTCACACATATAAGAGCAA 0: 1
1: 0
2: 0
3: 17
4: 146
Right 1031092957 7:117384290-117384312 ATAAGAGCAAATGTTGTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031092955 Original CRISPR TTGCTCTTATATGTGTGACA GGG (reversed) Intronic
905155446 1:35975332-35975354 TGGCCCTTATATTTGTGAAAAGG - Intronic
905553680 1:38864183-38864205 CTGCTCTTGTTTGTGTGACATGG - Exonic
906258087 1:44365936-44365958 CTTCTCTAATATGAGTGACAAGG - Intergenic
909938587 1:81584120-81584142 TTGCTTTTATATGTGCAGCAGGG + Intronic
911536589 1:99107429-99107451 TATCTCATATATGTGTGATATGG + Intergenic
918720755 1:187849963-187849985 TTTCTCTTTTGTGTGAGACATGG + Intergenic
918999236 1:191807492-191807514 TTGCCCTTAAATTTGTTACAAGG + Intergenic
920063918 1:203250990-203251012 TTGCTCTTGGATGTGTGAAATGG - Intronic
920077575 1:203348385-203348407 CTGCTCTCAGATGTTTGACATGG - Intronic
921388489 1:214595566-214595588 TTTCTGTTATATGTCTGACTTGG - Intergenic
1063689386 10:8271916-8271938 TTTATCTTATTTTTGTGACAGGG - Intergenic
1063713811 10:8507387-8507409 TTGCTCTTCTATGTTTGTCCTGG + Intergenic
1065658649 10:27981501-27981523 TTTCTCTTAAAAATGTGACAAGG + Exonic
1066373770 10:34839061-34839083 CTGCTTTTTTTTGTGTGACAGGG - Intergenic
1067787391 10:49260518-49260540 TTGCTTTTCTCTGTGTGAAATGG + Intergenic
1068926349 10:62543406-62543428 TCTTTCTTATATGTGTGATAAGG - Intronic
1073427304 10:103463201-103463223 TTGCTCTTAGCTCTGTGACATGG - Intergenic
1074983337 10:118637076-118637098 GTGCTTTGATATGTGTGAGATGG - Intergenic
1075581501 10:123622060-123622082 ATGTTTTTATATGTGGGACATGG - Intergenic
1077822366 11:5760373-5760395 TTTCTGTTAATTGTGTGACATGG + Intronic
1080280896 11:30555425-30555447 TGGTTCTTAGATGAGTGACATGG + Intronic
1080311043 11:30892636-30892658 ATGAACTTATATGTGTGAAAAGG - Intronic
1082964293 11:58949661-58949683 TTGGTCTTATATGTGTGGTGTGG - Intronic
1082973217 11:59045182-59045204 TTGGTCATGTATGTGTGGCATGG - Intergenic
1082977615 11:59088748-59088770 TTGGTCATATATGTGTGGCATGG - Intergenic
1086347508 11:85912239-85912261 TTCCTATTGTTTGTGTGACATGG + Intronic
1090570571 11:128040093-128040115 TTTCTAATATATGTGTGAAAAGG - Intergenic
1091483667 12:861491-861513 TTATTCTTATATCTGTGACTAGG + Intronic
1091735184 12:2915310-2915332 TTGCTGTGATATTTCTGACATGG + Intronic
1094101616 12:26770564-26770586 TTCCTCCTAGATGTATGACAAGG + Intronic
1095307603 12:40656555-40656577 TTAATCTTATATGTGTCACTTGG - Intergenic
1097806268 12:63968178-63968200 TTCCTCTTATATTTATGACAAGG + Intronic
1100659094 12:96677705-96677727 ATTCTCTTAAATGTGTGATAGGG + Intronic
1104510124 12:129369873-129369895 ATATCCTTATATGTGTGACAAGG - Intronic
1105929427 13:25038495-25038517 ATGCTTGTATATGTGTGAAATGG + Intergenic
1106636910 13:31538887-31538909 TTGCTCTTCTAGGAATGACAAGG - Intergenic
1107057279 13:36120064-36120086 TTGTTATAATATGTGAGACAGGG - Intronic
1110523819 13:76512772-76512794 ATGCTCTTATATGTGATTCAAGG + Intergenic
1112693325 13:101918942-101918964 TTGCTATTTTATGAGTGACTAGG - Intronic
1113157263 13:107337923-107337945 TTGCTGTTATTTGCGTGACACGG - Intronic
1113321190 13:109234194-109234216 TTGCTGTTCTCTGTGTGCCAAGG - Intergenic
1114737904 14:25062040-25062062 TTTCTCTTATCTGTGTCACTGGG + Intergenic
1115550285 14:34498978-34499000 CTGCTGTTATATTTGTGCCATGG + Intergenic
1115990957 14:39149323-39149345 TTGCATGTATTTGTGTGACAGGG - Exonic
1115996695 14:39202777-39202799 TTGAGTTTATATGTGTAACATGG - Intergenic
1116222002 14:42098682-42098704 CTACTCTTATGTGTGTGGCAGGG - Intergenic
1116705392 14:48290842-48290864 ATACTCTTGTATGTGTGCCAAGG - Intergenic
1118841786 14:69518946-69518968 TAGCTCTTATTTTGGTGACAGGG + Intronic
1120290093 14:82557392-82557414 TTAATCATATATGTGTGGCATGG + Intergenic
1123200083 14:106654810-106654832 TTGGTCTAATATCTGTAACAAGG + Intergenic
1124411795 15:29443214-29443236 TGGCTTTTACATGTGGGACAAGG - Intronic
1124911192 15:33922440-33922462 TTTCTCTTATTTTTGAGACAGGG + Intronic
1125096473 15:35858722-35858744 CTGTTCTTATAAGTTTGACATGG - Intergenic
1127909026 15:63400441-63400463 TTGCCCTTATATGTTAGACTTGG - Intergenic
1128669026 15:69560484-69560506 TTGCTGTTATTTTTGAGACAGGG - Intergenic
1129414200 15:75366201-75366223 TTGCTATTATTTTTGAGACAAGG + Intronic
1133476347 16:6125476-6125498 TTGCTCTTTGATGTTTTACAAGG + Intronic
1133501463 16:6371322-6371344 TTGCACTTATATGTGTGGGTTGG + Intronic
1133856846 16:9557845-9557867 TTGGTCTGATATGGGTCACATGG + Intergenic
1136561360 16:31040979-31041001 TTGCTATTATTTTTGAGACAGGG - Intronic
1137971281 16:52987362-52987384 CTGCTCCTATATCTGTGAAATGG - Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1140143165 16:72279038-72279060 CTGCTCTTGTTTGTGTAACATGG + Intergenic
1141259619 16:82440689-82440711 TTGCTCTTATCTATGTAACAGGG + Intergenic
1141519132 16:84566078-84566100 TTGCCCTTCTCTGTGTCACAAGG + Exonic
1143612541 17:8027639-8027661 TGGGTGTTGTATGTGTGACAAGG - Intergenic
1143759296 17:9089475-9089497 TTGCTCTAATGTGTTTAACAAGG - Intronic
1144028446 17:11299090-11299112 TAGCTCTTTTATTTGTGAAAGGG - Intronic
1145190401 17:20837110-20837132 TTTCTTTTTTGTGTGTGACAGGG - Intronic
1148781479 17:50124395-50124417 TTGCACTTATTTATGTGACTTGG + Intronic
1149283381 17:55132776-55132798 TGGCTCTTTTATGAGTGACTAGG + Intronic
1149624469 17:58070408-58070430 TTGCTGCTATGAGTGTGACAGGG + Intergenic
1150182125 17:63134030-63134052 GTGCTCTTGTATGTTTAACAGGG - Intronic
1153034524 18:748017-748039 TTGCTGTTTTATGTGTTGCAGGG - Exonic
1156599192 18:38584271-38584293 TTGCTCTTGTCCTTGTGACATGG + Intergenic
1162223472 19:9199575-9199597 TTCCACTTATCTGTGTGGCAGGG + Intergenic
1166422326 19:42648319-42648341 TTTCTTTTGTGTGTGTGACAGGG + Intronic
924965009 2:68034-68056 TTGCTGTTCTGTGTGTGACCAGG - Intergenic
935662889 2:105485125-105485147 TTTCTCTTATTTTTGAGACAGGG + Intergenic
939304316 2:140390430-140390452 TTGCTTTTTTATGTATGGCATGG - Intronic
940519864 2:154731209-154731231 CTGCCCTTCTATGTGAGACAGGG + Intronic
940767838 2:157809168-157809190 TTGCTATTTAATGTGTGACTTGG - Intronic
942672884 2:178395256-178395278 TTGTTGTTAAATGTGTGAAATGG - Intronic
943527532 2:189036334-189036356 TTCCTCTAATGTATGTGACATGG - Intronic
944321086 2:198343241-198343263 TGGCTCTTGTGTCTGTGACATGG + Intronic
1169542292 20:6613177-6613199 TTGCTTTCAAATGTGTGACATGG + Intergenic
1170849571 20:19992820-19992842 CTGCTCTTATATTAGTGAAATGG + Intronic
1172268232 20:33635873-33635895 TTACTTTTTTGTGTGTGACAGGG - Intronic
1173953914 20:47016104-47016126 TAGCTCTTTTGTGGGTGACAAGG + Intronic
1174792105 20:53488882-53488904 TTGCTATTATATGTGGCATAAGG - Exonic
1177496843 21:21902200-21902222 TTTCTCTTTTTTTTGTGACAGGG - Intergenic
1178307703 21:31504186-31504208 TTGCTGGCATATGTGTTACAAGG + Intronic
1181553525 22:23654383-23654405 TTGTTCTTATTTTTGAGACACGG + Intergenic
950976564 3:17252479-17252501 TTCCTCTTATATGTCAGGCAGGG - Intronic
954770184 3:52960446-52960468 TTATTCTAATATGTGTGAAATGG - Intronic
955510440 3:59675327-59675349 TTCCTCTTACCTGTGTGACTTGG + Intergenic
955633645 3:61002268-61002290 TTGCTTTTATTTTTGAGACAAGG + Intronic
956407325 3:68941402-68941424 TTCCTCTGATTTGTGTGACCTGG + Intergenic
956515572 3:70043122-70043144 TTGATCATATATGTGTTACAAGG + Intergenic
956972366 3:74541239-74541261 TTTCTCTCATATGGGTGTCAAGG - Intergenic
957008497 3:74978163-74978185 TTGCTTTTATATTTCTGAAATGG - Intergenic
957165675 3:76669687-76669709 TTGCTTTTATCTGTGTCCCAGGG - Intronic
957567151 3:81898911-81898933 TTGCTCTTATTTCTGTTACATGG - Intergenic
959300782 3:104598127-104598149 TAGATCTTATATGGGTGACCTGG - Intergenic
961903244 3:130235707-130235729 TTGCTCTTCAATATGTGAGAAGG - Intergenic
961917070 3:130387427-130387449 TTTCTTTTATATGTGTTACATGG + Intronic
963416687 3:145004365-145004387 ATCCTCTCATTTGTGTGACATGG - Intergenic
965500932 3:169455854-169455876 TTGCTCTTATTGGTTTGACGTGG + Intronic
969259460 4:6024298-6024320 TCACTCTTGTAGGTGTGACACGG - Intergenic
971852753 4:32004740-32004762 TTTCACTTATCTGTGTTACAGGG + Intergenic
971853881 4:32019117-32019139 TTGTTCTTAATTGTGTCACATGG - Intergenic
972374522 4:38458061-38458083 TTGATCATATATGTATGATATGG - Intergenic
973553132 4:52055103-52055125 TAGCCCATATTTGTGTGACAGGG + Intronic
973719148 4:53705867-53705889 TGACACTTATGTGTGTGACAGGG + Intronic
975332149 4:73129067-73129089 TTTCTCTTAGATCTGTGACAAGG - Intronic
978334198 4:107648229-107648251 CTGAGCATATATGTGTGACAAGG + Intronic
978832811 4:113109891-113109913 TTGAGCTTTTTTGTGTGACATGG - Intronic
981089110 4:140714308-140714330 TTGGTTTTATATGTTTTACAGGG + Intronic
982272776 4:153608111-153608133 TTGCTTTTATTTTTGAGACAGGG - Intronic
986987185 5:13513295-13513317 TTTTTCTTAAATGGGTGACAAGG + Intergenic
989405677 5:41058053-41058075 TGGCTCTTACCTGAGTGACATGG + Exonic
990847084 5:60154200-60154222 TTGCATTTATATGTATCACATGG + Intronic
992569162 5:78036364-78036386 TTGCTCCTATATATTTGAGATGG + Intronic
992619038 5:78574380-78574402 TGGCTCTCACATGTGTGCCATGG - Intronic
993699581 5:91102243-91102265 TTGCTCTGATTTCCGTGACATGG + Exonic
996000038 5:118349847-118349869 TTTCTAATATATGTGTAACAAGG - Intergenic
1000602559 5:163292439-163292461 ATGCTATGAAATGTGTGACAAGG + Intergenic
1002549913 5:179980309-179980331 ATTCTCTTATATGTAGGACATGG - Intronic
1003067688 6:2917741-2917763 TTGCTTTTTTATGTGTAAAAAGG - Intergenic
1006724370 6:36186284-36186306 TTTCTTTTCCATGTGTGACATGG + Intergenic
1008567162 6:52780693-52780715 TTTCTCTTATAAGTTTGACAAGG - Intergenic
1008570603 6:52813006-52813028 TTTCTATTATAAGTTTGACAAGG - Intergenic
1008824841 6:55681422-55681444 TTTTTCTTATATGTGTGATAGGG - Intergenic
1013158128 6:107513447-107513469 TGGCTCTTATAATTCTGACATGG + Intronic
1013228722 6:108141741-108141763 TTGCTTTTCTCTGTGTGAGATGG - Intronic
1013751411 6:113411121-113411143 TTGCCTTTATATGTGTAACAAGG - Intergenic
1013914832 6:115323731-115323753 TTGCTATTACATGTAGGACAAGG - Intergenic
1013980555 6:116122368-116122390 TTTCTCTTTTATGTCTGACAGGG - Intronic
1015079354 6:129204905-129204927 TGGCTCTTAAATGTATGAAACGG + Intronic
1021108177 7:16663536-16663558 TTTCTCTTTTATGTGTAAGAAGG + Intronic
1023430598 7:40087148-40087170 TTTTTCTTTTTTGTGTGACAGGG + Intronic
1027595985 7:80174780-80174802 TTAAACTTATATTTGTGACATGG - Intronic
1031092955 7:117384277-117384299 TTGCTCTTATATGTGTGACAGGG - Intronic
1034199820 7:149277151-149277173 TTGTTCTTTTATCTCTGACAAGG + Intronic
1034456166 7:151171816-151171838 TTGTTCTTATTTGTAAGACAGGG - Intronic
1039972130 8:42329327-42329349 TTGCTTGTTTATTTGTGACAGGG + Intronic
1040642784 8:49359166-49359188 TTGCTCTTATATGTTTTAATTGG - Intergenic
1041479520 8:58303509-58303531 TTGCAATTATAGGTGTGAAACGG - Intergenic
1041654796 8:60337926-60337948 ATGCTGTTAAATGTTTGACATGG - Intergenic
1042257824 8:66824148-66824170 TTACTTTTACATCTGTGACATGG + Intronic
1045448405 8:102292011-102292033 TTACTGTTATATGAGAGACATGG + Intronic
1055278610 9:74648480-74648502 CTACTCTTATCTGTGTGACGTGG - Intronic
1186201180 X:7156841-7156863 TTCCTCCTATGTGTGTTACATGG - Intergenic
1188277751 X:28221853-28221875 TTTTTCTTATATATGTGATAAGG + Intergenic
1188320123 X:28725843-28725865 TTGCTCTTAAAAGTGTTACAAGG - Intronic
1189738915 X:44098914-44098936 TTGCTCACAAATCTGTGACATGG + Intergenic
1189866469 X:45334424-45334446 ATGTTCTTATTTGTGAGACATGG + Intergenic
1189886223 X:45547169-45547191 TTGCTCTCATATGTGAGAATGGG + Intergenic
1192059176 X:67805715-67805737 TTGCTCATATATCTAAGACATGG + Intergenic
1195934948 X:110116085-110116107 TTACTTTTTTATTTGTGACAGGG - Intronic
1197189139 X:123625482-123625504 CTGCTTTTATATGTGTGTGAAGG + Intronic
1200130162 X:153837933-153837955 TTGCTCTTGTATGTATGCCTGGG + Intergenic
1200857019 Y:7949941-7949963 TGACTCTTATATGTGGGACCAGG - Intergenic
1201587302 Y:15575238-15575260 TTGCACTTGTATCTGTGTCAAGG + Intergenic