ID: 1031101510

View in Genome Browser
Species Human (GRCh38)
Location 7:117486452-117486474
Sequence TTCCTTGACCAGCCTTAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031101510_1031101515 -10 Left 1031101510 7:117486452-117486474 CCAGTCTAAGGCTGGTCAAGGAA 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1031101515 7:117486465-117486487 GGTCAAGGAAGGCTTGCTGGGGG 0: 1
1: 9
2: 133
3: 488
4: 1338
1031101510_1031101516 18 Left 1031101510 7:117486452-117486474 CCAGTCTAAGGCTGGTCAAGGAA 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1031101516 7:117486493-117486515 TCTTTTGTATTCACACCTAAAGG No data
1031101510_1031101517 21 Left 1031101510 7:117486452-117486474 CCAGTCTAAGGCTGGTCAAGGAA 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1031101517 7:117486496-117486518 TTTGTATTCACACCTAAAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031101510 Original CRISPR TTCCTTGACCAGCCTTAGAC TGG (reversed) Intronic
902203965 1:14853734-14853756 TTCCTTGAGCAGCCTGATTCTGG - Intronic
903023788 1:20412565-20412587 TACCTTGATCTGTCTTAGACGGG + Intergenic
904896565 1:33822430-33822452 TTCCATGGCCAGCCATAGCCTGG - Intronic
905489768 1:38334267-38334289 TTCCAGGACCAACCTTAGGCTGG - Intergenic
911085008 1:93969059-93969081 TTCCATCAACAGCCTTAGGCAGG + Intergenic
916926811 1:169530232-169530254 TTCCTTGACCTCTCTTAGCCTGG - Intronic
921664272 1:217849238-217849260 TTCCTTGTCCTGCCTGAGCCAGG + Intronic
922353159 1:224751752-224751774 ATCCTGGAGCAGCCTTAGAAAGG + Intergenic
1067804309 10:49382549-49382571 TTCCTTGCCCAGGCCTAGATTGG + Intronic
1070479442 10:76867900-76867922 TTACTGGACCAGCCTTTGAGAGG - Intergenic
1070609439 10:77923309-77923331 TTCCTTGAGGAGCCATAGTCAGG - Intronic
1071099998 10:82024937-82024959 TTCCTTGATCAGCCTGAGGCTGG + Intronic
1071315209 10:84388907-84388929 GTTCTTAACCAGCCATAGACTGG + Intronic
1071968173 10:90874035-90874057 TTACTTGACAAGCCCTAAACTGG - Intronic
1072615775 10:97048160-97048182 TTCCTTGCCCAGGCTGACACTGG + Intronic
1079869560 11:25780801-25780823 TTCCCTGACCAGCCTCAGGCTGG + Intergenic
1079869566 11:25780809-25780831 TTCCTTCCCCAGCCTGAGGCTGG - Intergenic
1080255192 11:30282397-30282419 TTCCTGGACCAGCCTTGTAGAGG - Intergenic
1084981316 11:72830205-72830227 TTCCTTTACCAACCTAGGACTGG + Intronic
1085048907 11:73369481-73369503 TTCCTGGAGGAGCCGTAGACAGG - Intergenic
1086803824 11:91213836-91213858 TTCTTTGTCCTGCCTTACACTGG - Intergenic
1092315264 12:7405707-7405729 TTACGTTACCAGCCTTACACAGG - Intronic
1092675520 12:10914483-10914505 CTCCTTGTCTAACCTTAGACAGG - Intronic
1093785422 12:23187144-23187166 TTTATTGACCAGCCTTGTACAGG + Intergenic
1093888542 12:24491338-24491360 TTCCTAGAGCAGCCTTTGCCAGG + Intergenic
1096205808 12:49720763-49720785 TTGCTTGTCCAACCTCAGACTGG + Intronic
1098781758 12:74695902-74695924 TTCCTTTACCAGACATAAACAGG - Intergenic
1099035720 12:77585129-77585151 ATCCTGGACCAGCAATAGACAGG - Intergenic
1099178286 12:79448613-79448635 TTCCTTAAACAACCTCAGACAGG + Intronic
1103207834 12:119144102-119144124 GTCCTAGATCAGCCCTAGACAGG + Intronic
1106566578 13:30889963-30889985 TACATAGGCCAGCCTTAGACAGG - Intergenic
1108283557 13:48883290-48883312 CTCCTTGACCAGCTTTGGTCAGG + Intergenic
1108502833 13:51084117-51084139 TTCCTTGACGTGTCTCAGACTGG - Intergenic
1110189210 13:72711779-72711801 TTCCTTGACCACCCTTTTATTGG - Intronic
1114212918 14:20631376-20631398 TTTCTTGACCAGGCTCGGACTGG + Intergenic
1116654978 14:47640865-47640887 TGCCTTTATCAGCCTTACACTGG - Intronic
1116898278 14:50338192-50338214 TTCCTTAGCCAGCCTTACTCTGG - Intronic
1117425130 14:55586310-55586332 TTCCTTAATGAGCCTTAGGCAGG - Intronic
1120193376 14:81459624-81459646 TTCCTTGTCCAGCCTTCTAGGGG + Intergenic
1121902696 14:97708432-97708454 TTCCTAGATAAGCCTTAGATTGG - Intergenic
1132228266 15:100160834-100160856 TTGATTAACCAGCATTAGACCGG + Intronic
1133861658 16:9600862-9600884 TTTCTTGAACATCCTTAGATAGG - Intergenic
1137065173 16:35833111-35833133 TTCCTGGTTCAGCCTTAGAAGGG + Intergenic
1137557978 16:49484631-49484653 ATCCTTGACCTGCCTGAGCCGGG - Intergenic
1139784842 16:69384583-69384605 TTCCTTGACCAGTTTTCTACTGG + Exonic
1147214396 17:38890868-38890890 TTGGTTGCCCAGCCTCAGACTGG - Intronic
1147816345 17:43213375-43213397 CTCCCTGGCCAGCCTGAGACTGG - Intronic
1149179119 17:53912907-53912929 TGCCTTGCCCAGCCTTGAACAGG - Intergenic
1150894949 17:69198757-69198779 TTTCCTGACCAGACCTAGACTGG + Intronic
1151243442 17:72776024-72776046 TTCCTGGACCAGCCTGATCCAGG - Intronic
1151262867 17:72930430-72930452 GTTCTTGTCCAGCCTGAGACAGG + Intronic
1158697892 18:59718911-59718933 TTCCTTTCCCTCCCTTAGACTGG - Intergenic
1161030494 19:2055961-2055983 TCCCTAGACCAGCCCTGGACAGG + Intergenic
1162110715 19:8398219-8398241 CTCCTTGGCCAGCATGAGACAGG + Intronic
1166884022 19:45947940-45947962 TCCCTTGCCCAGCATCAGACAGG - Intronic
1166990629 19:46690523-46690545 TTCCCTGACCACCCCTACACTGG + Intronic
1167611266 19:50508741-50508763 TTCCCTCACCACCCTTAGGCTGG + Intronic
925672361 2:6324939-6324961 TTCCTTGACCACCTTTACACGGG + Intergenic
929769670 2:44881056-44881078 TTATTTGACCAGCCTTAGCCTGG + Intergenic
930287560 2:49450690-49450712 TTTCTTGATAAGCTTTAGACGGG - Intergenic
931455625 2:62407812-62407834 TTCCTTTCCCAGTCTTAGAGAGG + Intergenic
932369472 2:71175431-71175453 GTCCTTGACCAGCTTTTGAGAGG + Intergenic
938016228 2:127869625-127869647 TTCCCTGACCAGCTTAACACAGG + Intronic
938558662 2:132450117-132450139 TTCCTTGACCTGCCAGAGCCTGG - Intronic
939104449 2:137932949-137932971 TTCCTAATCCAGCCTTATACTGG + Intergenic
945442275 2:209894245-209894267 TTCCTTGTCCAGCATTCGCCGGG + Intronic
946582603 2:221146029-221146051 TTCCTTGTGCAGCCTCAGAAAGG + Intergenic
946941043 2:224770496-224770518 TTCCTTGAACTTCCTGAGACAGG - Intronic
959404172 3:105940352-105940374 TTCCTTGACTAGTTTTAGACAGG + Intergenic
960761316 3:121076311-121076333 ATCCCTGACAAGGCTTAGACAGG - Intronic
960873996 3:122278524-122278546 TTCCTTGGCCAGAATTGGACAGG + Intronic
962285656 3:134084051-134084073 TTCCTTCACCAGCCCTAGCCAGG + Intronic
965733043 3:171792572-171792594 TTCCCTGCCCAGCCCCAGACTGG + Intronic
968569467 4:1331854-1331876 TTGGTTGCCCAGCCTTAGACTGG + Intronic
968599352 4:1501800-1501822 TTCCTTGGCCAGCCTTGGAGTGG - Intergenic
971405443 4:26318289-26318311 TTTCTATACCAGCCTTAGCCTGG - Intronic
972675040 4:41251913-41251935 CTGCTTGTCCAGCCTCAGACTGG + Intergenic
974930512 4:68356189-68356211 CTCCTTGACCAAACTTAGTCAGG + Intergenic
978954094 4:114594564-114594586 ATCCTTGGCAAGGCTTAGACAGG - Intergenic
981367852 4:143923802-143923824 TTCTTTGACCATCTTTTGACTGG + Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
988008653 5:25453670-25453692 TTCCTTGGTCAGACCTAGACTGG + Intergenic
989400620 5:41004224-41004246 TTCCTTGGCCTGCCCCAGACAGG - Intronic
997143456 5:131407304-131407326 TTCTTTGACCTGCCTTACATTGG - Intergenic
1005186945 6:23173104-23173126 TTCCTTGCTCACCCATAGACCGG - Intergenic
1006648772 6:35534264-35534286 TTTCTTGACCATTCTTAGAAAGG + Intergenic
1008141626 6:47838738-47838760 CTCCCTGTCCAGCCTTGGACTGG - Intergenic
1009302606 6:62044853-62044875 CTCCTTGACCAAACTTAGGCAGG - Intronic
1013420657 6:109963703-109963725 TCACTTCACCAGCCTAAGACTGG - Intergenic
1014246380 6:119074220-119074242 TTCCTTGACCAACTTTGGAAGGG + Intronic
1015711997 6:136152090-136152112 TGCCTTGGCCACCCTGAGACAGG - Intronic
1020613394 7:10428571-10428593 GTCCTTGGTCTGCCTTAGACAGG + Intergenic
1021021714 7:15608111-15608133 TACCCTGACCAGCTTTAGGCAGG + Intergenic
1028053088 7:86208711-86208733 GTCCATGAGCAGCCATAGACTGG + Intergenic
1031101510 7:117486452-117486474 TTCCTTGACCAGCCTTAGACTGG - Intronic
1036494813 8:9260638-9260660 TTCATTCAACAGACTTAGACTGG - Intergenic
1038058406 8:23884596-23884618 GTCCATGGCCAGGCTTAGACAGG - Intergenic
1042587453 8:70357431-70357453 TTACTTGACTAGCCTTAAAAAGG + Intronic
1052473918 9:28933768-28933790 TTGCTTGTCCAGCTTTGGACTGG + Intergenic
1052650102 9:31291097-31291119 TTCCTAGACCAGCCCTGTACAGG - Intergenic
1060094827 9:120779001-120779023 GTCCTTGACTTGCCTTAGAGTGG - Intronic
1201674826 Y:16569349-16569371 TTCCCTGACCAGACTTAGCTAGG + Intergenic