ID: 1031103167

View in Genome Browser
Species Human (GRCh38)
Location 7:117507241-117507263
Sequence CCTGAGGAGAAGGCAAGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 317}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031103167_1031103176 30 Left 1031103167 7:117507241-117507263 CCCGACCTTGCCTTCTCCTCAGG 0: 1
1: 0
2: 1
3: 36
4: 317
Right 1031103176 7:117507294-117507316 GCTAACATTCTCTGCTCTCCTGG 0: 1
1: 0
2: 0
3: 19
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031103167 Original CRISPR CCTGAGGAGAAGGCAAGGTC GGG (reversed) Intronic
900309060 1:2024706-2024728 CCGGAGGAGGAAGCCAGGTCAGG + Intronic
900336158 1:2164890-2164912 GCAGAGGAGAAGGCAAGGCAGGG - Intronic
900405426 1:2490867-2490889 CCTCAGGAGATGGCAGGGCCAGG - Intronic
900762309 1:4481615-4481637 CGTGGGGAGAGAGCAAGGTCTGG - Intergenic
900913264 1:5617175-5617197 CCTGAGCAGAAGGCAGGGCCAGG + Intergenic
901399959 1:9008987-9009009 CCTGCGGGGAAAGCAAGGCCTGG - Intronic
901433422 1:9232287-9232309 ACTGAGGTGAAGGTAAGGTGAGG + Intergenic
903791952 1:25899180-25899202 CCTCAGGAGAAAGCAAGGGAAGG - Intronic
904425574 1:30420640-30420662 CCCAAGGAGAAGGCAAGGCAAGG + Intergenic
904442531 1:30540947-30540969 CCTGAGGACAGGAAAAGGTCAGG + Intergenic
904671076 1:32166124-32166146 CAAGTGGAGAAGGCAAGGTAGGG - Exonic
906283441 1:44569694-44569716 CCTGCTGAGAAGCCAGGGTCTGG + Intronic
907118391 1:51989533-51989555 CCTGGGGAGGAGGCCAGGTGTGG - Intronic
907582801 1:55587066-55587088 AGTGAGGAGAAGAGAAGGTCAGG - Intergenic
908051030 1:60230691-60230713 TCTCAGCAGAAGGGAAGGTCAGG + Intergenic
910678549 1:89839721-89839743 CCGGAGGTGAAGACAAGGTAGGG + Intronic
911058727 1:93729723-93729745 CCTCAGAAGAAGGCAACGTCTGG + Intronic
912823858 1:112887924-112887946 CCTGAGCAGGAAGCAAGGTATGG - Intergenic
915515323 1:156409368-156409390 CATGGGGAGAAGGCAGGGGCAGG + Intronic
915682874 1:157598558-157598580 TCTGAGTAGAAGGCAAGCTGAGG + Intergenic
915955953 1:160220010-160220032 GCTGAGGAGAAGTCAAGGGCAGG + Intronic
917626701 1:176853774-176853796 CCTGAGGTCAAGGCAGAGTCGGG - Intergenic
917981107 1:180269969-180269991 CCCGAGGAGAAGGGAAGGCACGG + Intronic
918734935 1:188048509-188048531 CTGGAGGAGAAGGAAAGATCTGG + Intergenic
919013477 1:191996401-191996423 CCTGAGAAGAAGCCAAAGTTTGG - Intergenic
919160087 1:193817941-193817963 AGAGAGGAGAAGGCAATGTCTGG - Intergenic
921331103 1:214037295-214037317 CCTAAGGGGAAGGAAGGGTCTGG - Exonic
921623480 1:217352350-217352372 CCTGATGAGAAACAAAGGTCTGG - Intergenic
922471540 1:225880154-225880176 CCTGAGACGGAGGTAAGGTCAGG + Intronic
922471593 1:225880426-225880448 GCTGAGGAGAAGGCAGGGGGAGG + Intronic
923850621 1:237790336-237790358 CCTGTGGAGATGGCAAGAACTGG - Intronic
924040742 1:239981575-239981597 CCTGAGGGGAAGGCCCGCTCTGG + Intergenic
924134965 1:240956188-240956210 CCTGATGAGTAAGCAAGGGCTGG + Intronic
924481512 1:244439542-244439564 CTTGAGGAGAAGGAAGAGTCAGG - Intronic
1063907288 10:10794319-10794341 CCTGAGAAGAAGGCAAGAGCCGG + Intergenic
1064854462 10:19749968-19749990 CCAGAAGAGAACACAAGGTCAGG + Intronic
1065046201 10:21749289-21749311 CCTCCAGAGCAGGCAAGGTCGGG + Intergenic
1065814831 10:29474034-29474056 CCCGAGGAGAAGCAAATGTCTGG + Intronic
1067478735 10:46582198-46582220 CCTCTGGAGCAGGCAGGGTCTGG + Intronic
1068680115 10:59810219-59810241 CCTAAGGAGAATGCAAGGAATGG + Intronic
1068779272 10:60902059-60902081 CCTGGGGACAAGGCTGGGTCAGG + Intronic
1070102867 10:73405012-73405034 GCTGAGGAGATCACAAGGTCAGG + Intronic
1071519219 10:86318633-86318655 CCTGAGGACATGGCAGGGTGAGG + Intronic
1072437120 10:95423982-95424004 CTGGAGCAGAAGGCAAGGTAGGG + Intronic
1074968112 10:118511299-118511321 CCTGAGGAGGAGGAAAGGGAGGG + Intergenic
1075858904 10:125656854-125656876 GCTGGGGAGCAGGGAAGGTCGGG - Intronic
1075911378 10:126128192-126128214 CATGAGGACAAGGAAAGGTGAGG + Intronic
1077081340 11:725968-725990 CCTGGGCAGAAGGAAAGGGCTGG + Intronic
1077217765 11:1402178-1402200 CCTCTGGAGAGCGCAAGGTCAGG - Intronic
1077329604 11:1978231-1978253 CCTTTGGAGACGGCGAGGTCAGG + Intronic
1078708226 11:13765415-13765437 CCTGGGGAGAAGACAAGGCAGGG + Intergenic
1079353842 11:19714215-19714237 CCTGGGGAGGAGGAAAGGTCGGG + Intronic
1080747197 11:35118854-35118876 CATGAGCAAAATGCAAGGTCAGG - Intergenic
1081964341 11:47160632-47160654 CAAGAGGAGAAGGCTGGGTCAGG - Intronic
1083224550 11:61276680-61276702 CCTGAGGAGGAGGCAAGAGAGGG + Exonic
1083273817 11:61585958-61585980 CCTGGGGAGATGGCAAGGGCTGG + Intergenic
1083544223 11:63537163-63537185 CCTGAGGAGAAGCCAGAGTGTGG + Intronic
1084279519 11:68078336-68078358 CCAGGGCAGAAGGCAAGGTGAGG + Intronic
1084958727 11:72704857-72704879 CCTGACAAGGAGGCAAGGTGGGG - Intronic
1085031495 11:73273656-73273678 CCACAGGATAAGGCAAGGGCAGG - Intronic
1085055029 11:73398382-73398404 CCTGAGCAGAAGCCAAGCTGGGG + Intergenic
1088305746 11:108405472-108405494 ACTGAAGAGAAGGCAAGATTTGG - Exonic
1088394911 11:109356255-109356277 CCTGAACAGAAGGCAATATCTGG + Intergenic
1088465795 11:110136882-110136904 TCTGAAGAGAATGCAAGCTCTGG + Exonic
1089134614 11:116239223-116239245 CATGAGGGGAGGGCGAGGTCTGG - Intergenic
1089407941 11:118214253-118214275 TCTGAGGAGATGGCCAGGTCAGG + Intronic
1090650887 11:128804851-128804873 TCTGAAGAGCAGGCAAGGTCTGG - Intronic
1090919312 11:131194151-131194173 CCTGAGGAGACAGCAAAGGCTGG - Intergenic
1091354198 11:134923243-134923265 CTTGAGCAGGAGGCAAGGTAGGG + Intergenic
1202812583 11_KI270721v1_random:33410-33432 CCTTTGGAGACGGCGAGGTCAGG + Intergenic
1091397832 12:164507-164529 CAAGAGGAGAGTGCAAGGTCTGG - Intronic
1092217577 12:6693960-6693982 CCTGAGGAGGGGGAAAGGGCAGG + Exonic
1092285864 12:7129035-7129057 CCTCAGGAAAAGCCAAGGTCAGG - Intergenic
1095396887 12:41771887-41771909 TCTGAGGAGAGGGCATGATCTGG - Intergenic
1096365596 12:51026288-51026310 GGTGAGGGGAAGGCAAGGTCAGG - Intronic
1097034031 12:56110461-56110483 GCTCAGGAGAGGGCAAGGTGAGG + Exonic
1099993635 12:89753252-89753274 CCTGAGGAGGAGACCAAGTCAGG + Intergenic
1100804049 12:98262422-98262444 CCAGAGAGGAAAGCAAGGTCTGG + Intergenic
1101231600 12:102747088-102747110 CTTGCTGAGAAGGCAAGCTCTGG + Intergenic
1102220900 12:111193767-111193789 CCTGATGAGATGTCAAGGTCGGG + Intronic
1102402574 12:112642881-112642903 CCCCAGGGTAAGGCAAGGTCTGG + Intronic
1102655700 12:114480778-114480800 CTTCTGGAGAAGGCAAGATCCGG + Intergenic
1103164862 12:118761941-118761963 ACAGAGGAGCAGGCAAGGTTGGG + Intergenic
1103166544 12:118774647-118774669 GCTCAGGAGAGGGAAAGGTCTGG + Intergenic
1104261454 12:127187027-127187049 TCCGAGGAGCAGGCAAGATCTGG - Intergenic
1104826593 12:131714219-131714241 CTTGAGGAGGAGGCAAGGCAAGG + Exonic
1105418177 13:20231382-20231404 CCTGGGGAGCAGGAAGGGTCAGG - Exonic
1106725452 13:32479857-32479879 CCTCAGGAGAAGGGAAGTGCAGG + Intronic
1107276505 13:38686467-38686489 CACGAGGAGAAGGCAGCGTCTGG + Intergenic
1107448738 13:40489967-40489989 CCTCCGAAGAAGGCAAGGTTTGG - Intergenic
1109345740 13:61113283-61113305 GCAGTGGGGAAGGCAAGGTCAGG + Intergenic
1111375819 13:87378341-87378363 CCAGAGCAGAAGCCAAGGTTAGG - Intergenic
1113039795 13:106092305-106092327 CCTGCGGGGAAGGTAAGATCAGG - Intergenic
1113566002 13:111320197-111320219 CGTGGGGAGAAGGCAAACTCAGG - Intronic
1114651087 14:24284928-24284950 CATGAGTAGAAGGGGAGGTCAGG - Intergenic
1115163881 14:30426269-30426291 CCTGAGGAGGTGGCATGGTGCGG + Intergenic
1115771122 14:36664457-36664479 GCTTAGGACTAGGCAAGGTCAGG - Intronic
1117164825 14:53022874-53022896 CCTGAGGATAAGGGATGATCAGG - Intergenic
1117828542 14:59727512-59727534 CCCGAGGTCAAGGCCAGGTCCGG - Exonic
1119476859 14:74935324-74935346 CCTCAGGAAAAGGAAGGGTCCGG + Intergenic
1119738552 14:76999391-76999413 CCTGAGGAGAAGCCAATGTCTGG + Intergenic
1121671285 14:95712396-95712418 TCTGAGGAGAAGAAAAGGACAGG + Exonic
1122220787 14:100238407-100238429 CCTGAGGAGAAGGGAGGGAGGGG - Intronic
1122275349 14:100588007-100588029 CTTGGGGAGAAGGCAAGCCCTGG - Intergenic
1122505241 14:102227743-102227765 CTGGAGGAGGAGGCAAGGGCGGG - Intronic
1123162260 14:106289648-106289670 GCTGAGGAGAAGGCAGTGCCCGG + Intergenic
1123886815 15:24734766-24734788 GCTGAGGAGAACACAAGGTTGGG + Intergenic
1125239329 15:37555580-37555602 CCTGAGGGAAAGGCAAGTTTTGG - Intergenic
1126049848 15:44675709-44675731 CCAGAGGAGAAGGTAAGATGGGG + Intronic
1126232731 15:46345731-46345753 CAAGAGGAGTAGGCAAGGCCAGG - Intergenic
1126397688 15:48236331-48236353 CCTGAGCATAAAGCAAAGTCTGG + Intronic
1126852508 15:52805797-52805819 CCTGGCGGGAAGGCCAGGTCCGG + Intergenic
1128053260 15:64681865-64681887 CCTGAGGAAGAGGTAGGGTCAGG - Exonic
1128669334 15:69562834-69562856 TGTGAGGAGGAGTCAAGGTCTGG + Intergenic
1128727209 15:69997158-69997180 CCAGAGGAGAAGCAGAGGTCTGG + Intergenic
1129172772 15:73818025-73818047 CCTGAGCAGAAGGAAAGATGAGG + Intergenic
1129587545 15:76883492-76883514 CCTGGGTAGGAGGCCAGGTCAGG + Intronic
1133202102 16:4209977-4209999 CCTGAAGAGAAGGCACGTGCAGG - Intronic
1133267118 16:4591918-4591940 ACTGAGGAGGAGGGAAGCTCTGG + Intronic
1134129658 16:11640718-11640740 CTTGAGGAGAAGCCAAGCTGGGG - Intergenic
1135413860 16:22254325-22254347 CCTGAGGGGAAGGCAGGGAGCGG - Intronic
1135932990 16:26755136-26755158 CCTGGGGAGCAGGAAAGTTCTGG - Intergenic
1136372695 16:29846136-29846158 GCTGGGGAGAAGGCAGAGTCAGG - Exonic
1138307517 16:55990709-55990731 TGTGAAGAGAAGGCAAGATCAGG - Intergenic
1138441245 16:57036327-57036349 CCGGAGGTGAAGGCAAGGCATGG - Intronic
1138496461 16:57412017-57412039 CTTGAGGAGGGGGCAGGGTCAGG + Intronic
1138526399 16:57610209-57610231 CCTGAGGAGGTGGCAAGCACAGG - Intergenic
1141264783 16:82487085-82487107 GCAGAGCAGAAGGCAAGGTGGGG + Intergenic
1141523670 16:84598042-84598064 ACTGAGGATACAGCAAGGTCAGG + Intronic
1141640505 16:85338253-85338275 CCAGAGGTGAAGGCAAGATACGG - Intergenic
1141871522 16:86789718-86789740 CCCGAGGACAAGGCCACGTCGGG - Intergenic
1143263050 17:5614525-5614547 GAGGAGGAGAAGGGAAGGTCCGG + Intronic
1143772187 17:9175801-9175823 CCTGAGAACACGGCAAGATCAGG - Intronic
1145001077 17:19304990-19305012 CCTGTGGAGAAGGCAGGGTGAGG - Intronic
1145792965 17:27639239-27639261 CCTCAGGAGATGCCAAGGGCAGG + Intronic
1145903093 17:28500423-28500445 GCAGAGGAGAAGGCAAGGAAGGG + Intronic
1147914701 17:43879407-43879429 CAGAAGGAGAAGGCAAGGTAGGG + Intronic
1150507575 17:65715256-65715278 CCTGAAGAGAAGCCAGGGTCAGG + Intronic
1150623616 17:66826479-66826501 CCTGAGGAAATGGCAAGGGATGG - Intergenic
1151244244 17:72782170-72782192 CCAGAGGAGAAGACAATCTCAGG + Intronic
1151508672 17:74545034-74545056 CGTGTGGAGAAGGCAATGGCAGG + Intronic
1152142488 17:78545022-78545044 CGTGAGGAGGAGGAAAGGTGAGG - Intronic
1152504571 17:80739373-80739395 TCTGCGCAGAAGGCAAGGGCAGG + Intronic
1154138228 18:11799827-11799849 CCTGAGGACAAGGAAAAGTGGGG - Intronic
1154156929 18:11951136-11951158 GCTGGGGAGCAGGCCAGGTCAGG + Intergenic
1156466477 18:37350859-37350881 CAAGAGGAGAGGGCATGGTCAGG + Intronic
1157171169 18:45407073-45407095 CAGGAGGAGAAGTCAATGTCTGG - Intronic
1157523889 18:48364052-48364074 CCAGAGGAGAATGAATGGTCAGG - Intronic
1157603843 18:48913288-48913310 GCTGAGGAGCAGGCAAGGGCAGG + Intergenic
1159577150 18:70193305-70193327 CCAGAGGAGATGGCCAGGACTGG - Exonic
1159594042 18:70365517-70365539 TCTGATGAGAAGCCAAGTTCTGG + Intergenic
1159672517 18:71239316-71239338 GCTGTGGAGAACACAAGGTCAGG + Intergenic
1160088866 18:75807231-75807253 CCAGAGGAGAAAGCAACGTCCGG - Intergenic
1160660660 19:296915-296937 CCTGAGAAGAAGGTCAGTTCGGG + Intergenic
1160907178 19:1456831-1456853 CCTGGGGGGAGGGCAGGGTCAGG - Exonic
1161818671 19:6516074-6516096 ACTGAGGAGTGGGCAGGGTCTGG + Intergenic
1162021606 19:7870684-7870706 CCTGCAGAGGAGGCAAGGCCAGG + Exonic
1162177630 19:8843036-8843058 TCTGAAGAGCAGGCAAGGTGGGG - Exonic
1162892801 19:13746282-13746304 CCTGTGCAGAAGGCAGGGCCAGG + Intronic
1163158841 19:15453096-15453118 CCTGTGAACAAGGTAAGGTCAGG - Exonic
1164446783 19:28324440-28324462 CATGATGAGGAGGCAAGGGCCGG + Intergenic
1164511498 19:28900934-28900956 CTTGTGGATAAGGCATGGTCAGG + Intergenic
1164792910 19:31003144-31003166 CCTGAAGAGAAGAGAAGGTTGGG - Intergenic
1164823147 19:31265466-31265488 CCTGATGAGAAACCAAGGTATGG - Intergenic
1165909649 19:39217402-39217424 ACAGAGGAGGAGGCAAGGTGAGG + Intergenic
1166727409 19:45037434-45037456 CCAGAGAAGAAGTCAGGGTCTGG - Exonic
1166782601 19:45350319-45350341 CCTGCGGAGAAGGGAGTGTCTGG - Exonic
1166895252 19:46018534-46018556 CCTGGGGAGAGGGCAGGGTCAGG - Exonic
1167419990 19:49397229-49397251 CAAGAGGAGAAAGCAAGGGCCGG + Intronic
1167690017 19:50979673-50979695 CCTGGGGGGAGGGCAAGGCCGGG + Intronic
926123104 2:10255477-10255499 CCTGAGGACAATGCCAGGTCGGG + Intergenic
928315388 2:30240549-30240571 CTTGAGGACAAGGGAAGGGCAGG - Intronic
930198191 2:48529751-48529773 CCAGAGGTGAGGACAAGGTCTGG + Intronic
931178347 2:59875566-59875588 CCTGAAGAGGAGCCAAGGTCTGG - Intergenic
934026175 2:88003268-88003290 CCTGAGGAGGAGGCACGGGGAGG - Intergenic
934323481 2:91986101-91986123 GCCAAGGAGAAGGCAGGGTCGGG - Intergenic
936163536 2:110102121-110102143 CCTGAGGAGAAAGGAGGGTATGG - Intronic
936276486 2:111102169-111102191 ACTGAGGAGCATGCAAGGTCAGG - Intronic
936925832 2:117735869-117735891 CCTGAGGAGCAGGCAATATTTGG + Intergenic
937189381 2:120079747-120079769 CTTGAGGAGAAGACAAAGGCAGG - Intronic
937855435 2:126669319-126669341 CCTGAGGAGGGGGCATGGCCTGG - Intronic
941902466 2:170691569-170691591 CCTGAGCAGAAGGCAGAGCCTGG - Intergenic
942311535 2:174661350-174661372 CCAGAGGTGTAGGCAAGGGCAGG - Intronic
943482282 2:188435093-188435115 ACTGGGGAGAAGACAAGGCCAGG - Intronic
947210241 2:227701707-227701729 CCAGAGAAGGAGGCAAGGGCTGG + Intronic
948197539 2:236106777-236106799 CAAGAGGACCAGGCAAGGTCTGG + Intronic
948296282 2:236863050-236863072 CCTGAGAAGAAGGCAGGGCAGGG - Intergenic
1169774211 20:9234685-9234707 CCTGAGGAAAAAGGAAGGTAAGG + Intronic
1169797180 20:9475824-9475846 CCTCATAAAAAGGCAAGGTCTGG + Intronic
1169870472 20:10243115-10243137 TCTGATGTGCAGGCAAGGTCTGG - Intronic
1172314067 20:33939934-33939956 CCGGAGCAGGAGGCAAGGACAGG + Intergenic
1174774587 20:53332062-53332084 CCTGTGCAGAAGGCAGGGTGGGG + Intronic
1174805003 20:53597634-53597656 TCAGAAGAGAAGGCAGGGTCTGG + Intronic
1175375020 20:58518329-58518351 CCTGAGCAAAATGCAAGATCTGG - Intergenic
1176085043 20:63292090-63292112 CCAGAGCAGCAGGCAGGGTCGGG + Intergenic
1178053866 21:28777402-28777424 CCTGAGGAGAAGTCAATTTTGGG - Intergenic
1179631278 21:42680130-42680152 CCTCAGGAGAAGGCACAGGCAGG - Intronic
1179635001 21:42703232-42703254 CATGAGGAGCAGGCAGAGTCAGG + Intronic
1179882871 21:44300646-44300668 CCCGAGGAGGAGGCGCGGTCCGG - Intronic
1179897027 21:44368939-44368961 CCTGAGGAGGCGGCAGGGACCGG + Intronic
1179997431 21:44980468-44980490 CCTGAGAAGAAGGGGAGGGCCGG - Intergenic
1180082836 21:45494452-45494474 CCTGTGGCGAAGGCACGGTTAGG - Intronic
1181186175 22:21105994-21106016 CCTGAGGAGAGGGGAAGGAGGGG - Intergenic
1181476195 22:23169115-23169137 CCTGAGGAGGGGCCCAGGTCTGG + Intergenic
1183084511 22:35478325-35478347 GCTGAGGAGAAGCCCAGGTGGGG + Intergenic
1183156723 22:36081410-36081432 CCAGAGGAGAAGGAAAGGCCAGG - Intergenic
1183338494 22:37264872-37264894 CATGAGGAGAAGGCAGTGTTTGG - Intergenic
1183743384 22:39680261-39680283 CCTGAGGTGGAGGCCAGGACAGG - Intronic
1184090655 22:42291360-42291382 CCTGAGGAGAGGGCAGTGTGTGG + Intronic
1184244828 22:43230672-43230694 CCTGAGGAGAAGACAGGGCCAGG + Intronic
1184682430 22:46079480-46079502 CCTGAGGCGGTGGCAAGGTTTGG + Intronic
1184728386 22:46358976-46358998 ACTGGGGAGAAGGCAGGCTCAGG - Intergenic
1184833988 22:47009856-47009878 CCTCAGGAGCAGGCATGGACAGG - Intronic
1185148628 22:49152211-49152233 CCTGAGATCAAGGCAAGGACCGG - Intergenic
1185304141 22:50103257-50103279 CCTCAGGAGCAGGCCAGGGCTGG - Intronic
949319387 3:2791857-2791879 ACAGAGGAGAAGGCAATGTGAGG - Intronic
950469586 3:13176240-13176262 CCTGAGGTTGAGGCAAGTTCAGG - Intergenic
952763285 3:36934264-36934286 CCTGAGAAGAAGCCAATTTCTGG + Intronic
953144135 3:40258260-40258282 CCTGAGGAGAAGGCCTGGGGAGG + Exonic
953517866 3:43613939-43613961 CCTCAGGAGAGGGCACTGTCTGG + Intronic
953609063 3:44432551-44432573 CCTGAGGAGAACATAAAGTCTGG - Intergenic
953762892 3:45706207-45706229 GGTGAGGAGGTGGCAAGGTCAGG + Intronic
955334750 3:58075922-58075944 GCTGCAGAGAAGGCAAGGGCAGG + Intronic
955426636 3:58797702-58797724 CTAGAGGAGAAGTCAATGTCTGG + Intronic
955862444 3:63345684-63345706 CCTGAGGAGAGGGGAAGGGAGGG + Intronic
956745469 3:72307475-72307497 CCTGACCAGCAGGCAAGGTGTGG + Intergenic
956799032 3:72740142-72740164 CTGGAGCTGAAGGCAAGGTCAGG - Intergenic
957385410 3:79490252-79490274 CCAGAGTATAAGGCAAGGACAGG - Intronic
959834431 3:110901968-110901990 ACTGAGGGGAAGGTAAGGGCAGG - Intergenic
960180394 3:114568961-114568983 ACTCAGGGGAAGGCAAGGCCAGG - Intronic
960401435 3:117204231-117204253 CTTGAGGAGAAGGAGAGGTGTGG - Intergenic
961933117 3:130554696-130554718 CCTGTGGAGAAGGGGAGGTGAGG + Intergenic
962711047 3:138086438-138086460 CCTGAGCAGGAGGCAAGTTGAGG - Intronic
962919206 3:139935704-139935726 GCTGAGCAGAAGGCGAGGTCTGG + Intronic
965347732 3:167572920-167572942 CCTGAGGAGAAGCAGAGGTAGGG + Intronic
965371005 3:167862837-167862859 CCTAAGGAAAAGGCAAAGACTGG + Intergenic
967101695 3:186221213-186221235 GCTGAGGGGCAGGCAAGGCCAGG + Intronic
967264421 3:187677743-187677765 CCTGGGGTGAAGCCAAGGTTAGG - Intergenic
969566847 4:7983756-7983778 CCAGAGCAGGAGGCATGGTCAGG + Intronic
970895478 4:21098368-21098390 GCTGTGGAGAAGTCAATGTCTGG + Intronic
971074967 4:23137595-23137617 CCTAAGGGAAAGGAAAGGTCAGG - Intergenic
971143064 4:23946003-23946025 CCTGGGGAGGAGGGAGGGTCCGG - Intergenic
971327366 4:25655479-25655501 CTTGAGGAGAAGGCAGGGGCGGG + Intronic
971779536 4:31014509-31014531 ACTGAGCAGAAGGCAAGGGAAGG + Intronic
974783761 4:66590308-66590330 CATGAGGACAAGGCAGGGACAGG - Intergenic
975115136 4:70671775-70671797 ACTGGGCAGAACGCAAGGTCAGG + Intronic
976938655 4:90672216-90672238 CTGGAGGAGAAGTCAAGGGCTGG - Intronic
979485686 4:121267350-121267372 CCTGGGAGGAAGGCAAGCTCTGG + Intergenic
979523033 4:121690040-121690062 CCAGAGGAGAAGGAAAGGGAAGG + Intronic
981307131 4:143258603-143258625 CCTGAGGTGAAGGTAAAGTTTGG - Intergenic
981848642 4:149201022-149201044 CCTGGGGAGGAGGCAAGGATAGG + Intergenic
983831180 4:172329870-172329892 ACTGAAGAGAAAGCGAGGTCAGG + Intronic
985543724 5:498964-498986 CCTGAGGAGGTGCCAAGGCCAGG + Intronic
986770303 5:10966744-10966766 ACTGAGGAGAAAGCCAGGTGGGG - Intergenic
987726660 5:21709404-21709426 CCTGAGGAGAAGGAAAGAGATGG - Intergenic
988728705 5:33948819-33948841 GCAGAGGAGAAGGCAAAGTAGGG + Intronic
991396541 5:66209948-66209970 CAAGCTGAGAAGGCAAGGTCAGG - Intergenic
992758209 5:79929135-79929157 CCTGAGCAGAAGGGAAGGCCAGG + Intergenic
995339478 5:111041755-111041777 CCAGAGGAGAAGTCAATGCCTGG - Intergenic
995525822 5:113049843-113049865 CCTGAGAAGTAGGCAAGAGCTGG - Intronic
996350333 5:122533263-122533285 CTTGAGGGAAGGGCAAGGTCTGG + Intergenic
997413659 5:133708683-133708705 CCAGAGGGGAAGGTAATGTCAGG - Intergenic
997461952 5:134058887-134058909 CCTGGGGAGAGGGCAAGGTGGGG - Intergenic
999310619 5:150549419-150549441 CCTGAGGGGCAGGCAGGGTTTGG + Intronic
1000082091 5:157858541-157858563 CCTGGGGAGCAGGGAAGGTTTGG - Intronic
1000312836 5:160061888-160061910 CCTGTGGAGGAGGAAAGGCCGGG + Intronic
1001718861 5:173840177-173840199 TCTGAGGAGAAGGAGAGGGCAGG + Intergenic
1002098146 5:176844212-176844234 CCTGAGGATCAGGCAAGGCCTGG - Intronic
1002328381 5:178424927-178424949 CCTGAGGAGGAGGCGAGGCCAGG - Intronic
1002534703 5:179869834-179869856 CCTGTGGAGAAGGCCAGGGAGGG + Exonic
1003202484 6:3974606-3974628 CCTGAGGACCAGGCAAGGCTGGG - Intergenic
1003488320 6:6598781-6598803 TATGTGGAGAAGGCAAGGGCAGG - Intronic
1006718013 6:36132378-36132400 GCTGGGGAGAAGGGAAGGTGGGG - Intronic
1006929270 6:37678001-37678023 CCTGGGTAGAAGCCAAGGCCTGG - Intronic
1006989079 6:38197942-38197964 GCTGAGGAGAGGGCGAGGACTGG + Intronic
1007469111 6:42076836-42076858 CCTCTGGAGAAGGCAGGGACAGG - Intronic
1007483325 6:42164144-42164166 CCAGAGGAGACGGCAAGGATGGG - Intronic
1007685288 6:43663578-43663600 CCTGAGGAGAGGGAGAGGGCTGG + Intronic
1008298984 6:49811095-49811117 ACAGAGGAGAAGTCAATGTCTGG - Intergenic
1012564890 6:100636429-100636451 CCTGAGGAGAAGGAAAGAGATGG - Intronic
1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG + Exonic
1015810552 6:137158219-137158241 GTTGAGAAGAAGCCAAGGTCAGG - Intronic
1017743692 6:157428275-157428297 GCAGAGGAGCTGGCAAGGTCGGG - Intronic
1017973260 6:159331288-159331310 CCTGAGGAGAGGGCTAGTTTTGG - Intergenic
1018795540 6:167182496-167182518 CCTATGGGGATGGCAAGGTCAGG - Exonic
1018820780 6:167372567-167372589 CCTACGGGGATGGCAAGGTCAGG + Exonic
1019018242 6:168896226-168896248 CCTGAGAAGAAGGCAGGAACCGG + Intergenic
1019080173 6:169424985-169425007 GCTGAGGAGATGCCAAGGTCAGG - Intergenic
1019649968 7:2151558-2151580 GCAGAGCAGAAGGCAGGGTCAGG + Intronic
1020154737 7:5713470-5713492 ACTGAGGGGGAGGAAAGGTCTGG - Intronic
1020187386 7:5969751-5969773 CCTGTGGTGAAGGCCAGGTCTGG + Intronic
1020295530 7:6755019-6755041 CCTGTGGTGAAGGCCAGGTCTGG - Intronic
1022163324 7:27733315-27733337 CTTCAGGAGAAGCCAAGGGCAGG - Intergenic
1022441462 7:30436617-30436639 CCTGAGGACAAGGAAGGGGCAGG + Intronic
1022500233 7:30878130-30878152 CCTGAGGAGAGGGCCAGGCCAGG - Intronic
1022702217 7:32772127-32772149 ACTGAGGAGATGGCAAGGCTGGG - Intergenic
1022906445 7:34862269-34862291 ACTGAGGAGATGGCAAGGCTGGG - Intronic
1022967076 7:35483754-35483776 TCTAAGGAGAAGGCAAGGCAGGG + Intergenic
1023867874 7:44247384-44247406 CCAGAGGGGAAGGCAGGGCCAGG - Intronic
1024797340 7:53035791-53035813 CCTGGGGAGATGGCGTGGTCTGG - Exonic
1028959969 7:96737758-96737780 CCTGAGGAAAAGGCCATGTGAGG + Intergenic
1029445833 7:100612485-100612507 CGTGAGGAGAAGGCCGGGTTGGG + Intronic
1029838648 7:103339404-103339426 CTTCAGGAGAAGGCAGAGTCGGG - Intronic
1030124328 7:106140210-106140232 CCTGATGAGAAAGCCATGTCTGG + Intergenic
1031103167 7:117507241-117507263 CCTGAGGAGAAGGCAAGGTCGGG - Intronic
1033640287 7:143256731-143256753 GCTGAGGAGAACACAAGGTCAGG - Intronic
1033845931 7:145432150-145432172 CCTGAGGAGAAGGAGAGATGAGG + Intergenic
1035375133 7:158402668-158402690 CCTGCAGGGAAGGGAAGGTCTGG + Intronic
1036146766 8:6261281-6261303 TCTGAGGAAAAGAGAAGGTCAGG + Intergenic
1036802935 8:11806292-11806314 CCAGGGGAGAAAGCAAGCTCAGG - Intronic
1037319215 8:17628370-17628392 CCTTAGGAGTAGGAAAGGCCGGG - Intronic
1037974269 8:23199054-23199076 TCTGAGGACATGGCAAGGACAGG + Intronic
1039972171 8:42329731-42329753 CCTGAGGACAAGGCCATGGCTGG - Intronic
1040425689 8:47283280-47283302 CCTAAGGAGAAGGCAAGAGATGG + Intronic
1041153675 8:54961919-54961941 CCTGGGGAGAAGTGAAGGGCTGG + Intergenic
1041386942 8:57314132-57314154 CATGAGGACAAGGCTAGGTGTGG + Intergenic
1042852916 8:73234548-73234570 CCTGAGGAGAAAGGGAGGTGGGG - Intergenic
1043275770 8:78390429-78390451 CCAGAGGAAAAGTCAAGGCCTGG + Intergenic
1044729787 8:95220552-95220574 GCTGAGGTGGAGGCAAGGGCTGG - Intergenic
1047425513 8:124741931-124741953 CCTGGGGAGACAGAAAGGTCAGG - Intergenic
1047907192 8:129484741-129484763 CCTGGGGAAAAGGGAAGGGCAGG - Intergenic
1048267877 8:133003777-133003799 GCAGAGGAGAAGGAAGGGTCTGG - Intronic
1049291981 8:141808325-141808347 CCAGAGGGGCGGGCAAGGTCTGG + Intergenic
1050319485 9:4436507-4436529 CCTTAAGAGACGGCAAGGACTGG + Intergenic
1050601483 9:7257332-7257354 TCTGAGGAGAAGTCAATGGCTGG - Intergenic
1051814673 9:21091562-21091584 GCTGGGGAGAAGACAAGTTCAGG - Intergenic
1052235704 9:26211562-26211584 CCTGAAGAGCATGCAGGGTCAGG + Intergenic
1052330409 9:27261568-27261590 CATGTGGAAAGGGCAAGGTCAGG + Intergenic
1053271783 9:36755034-36755056 CCAGAGCTGAAGGCAAGGTCAGG - Intergenic
1054355003 9:64051911-64051933 CCAGGGGAGGAGGCAAGGTGAGG - Intergenic
1054722149 9:68614976-68614998 TCTGAGGCGAAAGCAAGGGCGGG - Intergenic
1056299930 9:85230353-85230375 GCTGGGGAGAAAACAAGGTCAGG - Intergenic
1056670109 9:88620213-88620235 ACTGAGGAGAACACAAGGTTGGG - Intergenic
1058694419 9:107547336-107547358 CCAGAGGAGGGGGCAAGGGCAGG + Intergenic
1058851601 9:109016880-109016902 TCAGAGGAGACTGCAAGGTCAGG + Exonic
1059632554 9:116140352-116140374 ACAGAGGAGAATGCAAGGGCTGG - Intergenic
1059744145 9:117183938-117183960 CCAGAGGAGAAAGCAATTTCTGG - Intronic
1059755436 9:117289169-117289191 CCTGAGGGGAGGGCAGGGACAGG + Intronic
1059998733 9:119939252-119939274 AGAGAAGAGAAGGCAAGGTCAGG + Intergenic
1060679081 9:125545398-125545420 TCTGAGGAGAAAGCAAGGGAAGG - Intronic
1060849902 9:126866020-126866042 CTTGAGGAGAGGGCTAGGTGAGG + Intronic
1061130871 9:128707032-128707054 CCTTAGGAGAGGGCCAGGGCTGG - Intronic
1061648993 9:132030973-132030995 CCTGAACAGAAGGGAAGGTTGGG + Intronic
1061757898 9:132827916-132827938 CCAGAGCAGAATGCGAGGTCAGG + Intronic
1203792704 EBV:160199-160221 GCTGAGGAGAAGGCGAGGCCGGG - Intergenic
1186761901 X:12732037-12732059 GGGGAGGAGAAGGTAAGGTCAGG - Intergenic
1188313729 X:28648571-28648593 CCAAAGGTGAAGGCAAGGTCGGG + Intronic
1189143729 X:38634894-38634916 CCTGATAAGAAGCCATGGTCAGG + Intronic
1190265327 X:48824522-48824544 CCTGAGGAGGAGGCAAGAATAGG - Exonic
1190909271 X:54757202-54757224 CCAGAGGACCAGGCAAGTTCTGG - Exonic
1192240345 X:69323396-69323418 CCTGAGGCAGAGGCAAGGTGAGG + Intergenic
1192823222 X:74666413-74666435 CCTGAAGAGAAGGCAAGGCTTGG - Intergenic
1194939706 X:99995042-99995064 GCTGGGGAGAACACAAGGTCAGG - Intergenic
1195125213 X:101802218-101802240 TCTGCAGAGAAGGCAAGGTGAGG - Intergenic
1195179527 X:102343431-102343453 TCTGCAGAGAAGGCAAGGTGAGG + Intergenic