ID: 1031105493

View in Genome Browser
Species Human (GRCh38)
Location 7:117536991-117537013
Sequence TTGGTAACTCACATGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031105493 Original CRISPR TTGGTAACTCACATGGAACT GGG Intronic
906125844 1:43426528-43426550 TGGGGAACTCACCTGGAACGTGG - Intronic
908683772 1:66691479-66691501 TTGGTAACTCACAAGAAACTAGG - Intronic
909283004 1:73780854-73780876 TAGGAGACTCACATAGAACTAGG + Intergenic
910586923 1:88890972-88890994 TTGGTAAGCCAGATGGAACCTGG - Intronic
911235995 1:95413023-95413045 TTGGAGATTCACATGAAACTGGG - Intergenic
913281987 1:117194714-117194736 GTGGTAACACAGATGGAACCTGG + Intronic
1064870622 10:19933106-19933128 TGGGTAACTCACTTGGTACTTGG + Intronic
1065998394 10:31081117-31081139 TTGGTAACTAACCTGTCACTTGG + Intergenic
1068896426 10:62208635-62208657 TTGGTAACTGACATATAAATGGG + Intronic
1076470069 10:130712313-130712335 ATGGAAACTTACATGGAACAAGG + Intergenic
1079564243 11:21861950-21861972 TTGATAATTCAAATGGCACTTGG - Intergenic
1080757852 11:35219377-35219399 TTTGAAACTCACCTGGAATTTGG - Exonic
1082688544 11:56271045-56271067 GTGGTAATTCACCTGAAACTTGG - Intergenic
1085094560 11:73749347-73749369 TTGGGGACTCACAGGGAAGTGGG + Intronic
1086222881 11:84471128-84471150 CTGGCAACCCAGATGGAACTGGG + Intronic
1090296403 11:125592245-125592267 TTGGTAACTGCGATGGACCTGGG - Intronic
1092710963 12:11336996-11337018 TTTGTAACTCTCATAGAATTCGG + Intergenic
1093096242 12:14975336-14975358 TTTGTAATTCAAATTGAACTGGG + Intronic
1093692488 12:22123808-22123830 TTGGTAACTCACCAGCAAATAGG - Intronic
1095637235 12:44448893-44448915 TGGGAAACACACATGGACCTGGG - Intergenic
1098779743 12:74671744-74671766 TTGGTAATTCTGATGGATCTGGG + Intergenic
1099390619 12:82074418-82074440 TTTTTAACTGACATGTAACTGGG - Intergenic
1101405744 12:104427107-104427129 TTAGTAAGTCACATGCAAATTGG + Intergenic
1103034477 12:117645456-117645478 TTGGGAAATCCCATAGAACTTGG - Intronic
1104176864 12:126341436-126341458 TTGGTAACTCCCAAGGAAGTTGG + Intergenic
1107388608 13:39940318-39940340 ATGGTAAAACACATGGCACTTGG - Intergenic
1111219300 13:85182807-85182829 TTGGTTACTTACAAGGAAATAGG + Intergenic
1112581883 13:100683333-100683355 TTTGTAGCTCTCATGGAATTTGG + Intergenic
1114059049 14:19002225-19002247 TTGCTAACTCACATGTCTCTGGG + Intergenic
1114103494 14:19399529-19399551 TTGCTAACTCACATGTCTCTGGG - Intergenic
1118879231 14:69811857-69811879 TATGTAACCCACATGGACCTAGG - Intergenic
1133231752 16:4370265-4370287 TTGGAAACTCAGATGGTTCTGGG + Intronic
1134872255 16:17662544-17662566 TTAGTTTCTCACATGAAACTAGG - Intergenic
1136731646 16:32419032-32419054 TTGGTAACTTGCATGTTACTAGG + Intergenic
1138664691 16:58555347-58555369 CTGGTCACTTACATGGCACTAGG - Exonic
1139102981 16:63790707-63790729 TTTGTAACACACATGGTACTTGG - Intergenic
1140341316 16:74166417-74166439 TTAGCAACTCACAAGGAACCTGG - Intergenic
1202994743 16_KI270728v1_random:98242-98264 TTGGTAACTTGCATGTTACTAGG - Intergenic
1203021430 16_KI270728v1_random:410584-410606 TTGGTAACTTGCATGTTACTAGG - Intergenic
1143854341 17:9837576-9837598 TTTTTAACTCCCATGGGACTTGG + Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1150314894 17:64160612-64160634 TTGGGAACTCACAGGCCACTGGG + Intronic
1153553433 18:6285423-6285445 TTGAAATCTCACATGGAAATCGG - Intronic
1154266016 18:12879832-12879854 TTGGTAATGCTCATGGAGCTGGG - Intronic
1155861930 18:30912217-30912239 TGGGTAACTTCCATGGGACTTGG - Intergenic
1156602950 18:38631476-38631498 TTGCTAACTCACATTGAAGTGGG - Intergenic
1159084317 18:63771053-63771075 TGGGTAGGTCACATGGCACTGGG + Intronic
1159996982 18:74974667-74974689 TTAGTACCCCACATGGAAGTTGG + Intronic
1161853200 19:6749564-6749586 TTGTTAAATCACATGGAGCCCGG + Intronic
1161914326 19:7217395-7217417 TTGGTACCTCACTTGGCACAAGG - Intronic
1162070631 19:8149963-8149985 TTGGAAACTCACCTGGCTCTTGG + Intronic
1167777281 19:51566674-51566696 TATGTAACTCTCATGGACCTAGG + Intergenic
1167835959 19:52070259-52070281 TATGTAACCCACATGGACCTAGG + Intronic
1167866365 19:52331886-52331908 CTTGTAACCCACATGGACCTAGG - Intergenic
927575669 2:24200213-24200235 TTAGGAACAGACATGGAACTGGG - Intronic
930474066 2:51856528-51856550 TTAGAAAGTCACATGGAAGTAGG - Intergenic
931973461 2:67616174-67616196 CTGGGAACTCAGAAGGAACTAGG + Intergenic
934160438 2:89244506-89244528 TTGTTTACTCACAGGGCACTTGG + Intergenic
934206839 2:89937932-89937954 TTGTTTACTCACAGGGCACTTGG - Intergenic
934314074 2:91900247-91900269 TTGGTAACTTGCATGTTACTAGG - Intergenic
935005585 2:99072952-99072974 TTTGTACCTAACATGGTACTTGG + Intronic
938282136 2:130072007-130072029 TTGCTAACTCACATGTCTCTGGG - Intergenic
938332763 2:130460579-130460601 TTGCTAACTCACATGTCTCTGGG - Exonic
938357045 2:130660092-130660114 TTGCTAACTCACATGTCTCTGGG + Intergenic
938433479 2:131266898-131266920 TTGCTAACTCACATGTCTCTGGG + Intronic
938477521 2:131629484-131629506 TTGCTAACTCACATGTCTCTGGG + Intergenic
940161458 2:150718127-150718149 TTGTTTACTCACAGAGAACTTGG - Intergenic
940509896 2:154600488-154600510 TGGGTAACTCAAATGGAAATAGG - Intergenic
942725854 2:179006919-179006941 TTGGTTTCTCACATGGAAGGAGG - Intronic
945517268 2:210778000-210778022 TAGGTAAATCACATGGAATTGGG - Intergenic
946928660 2:224650869-224650891 TTGGTATGTCACAGGGAACTTGG + Intergenic
947173801 2:227339470-227339492 TTGCTCACTCACATGTCACTTGG + Intronic
948867140 2:240781958-240781980 TGGGAAACGCACAGGGAACTCGG - Intronic
948953145 2:241268008-241268030 TTTGGAGCTCACCTGGAACTGGG - Intronic
1174861829 20:54098490-54098512 TTTGTTACTCACCTGAAACTTGG - Intergenic
1175677490 20:60959184-60959206 TGGGAACCTCACATGGACCTGGG - Intergenic
1176668557 21:9710514-9710536 TTGTGGACTCACATGGATCTTGG + Intergenic
1180477533 22:15724841-15724863 TTGCTAACTCACATGTCTCTGGG + Intergenic
1182978213 22:34643191-34643213 TTGGGAACTTGGATGGAACTCGG - Intergenic
1183105794 22:35614156-35614178 TTGGACACTCACATGGAACATGG + Intronic
949977439 3:9473868-9473890 TTGTTAATTCATGTGGAACTTGG - Intronic
951106365 3:18747948-18747970 GTGGTAACTTACATGGATCATGG + Intergenic
952158293 3:30667567-30667589 TTGGTTTCTGACATTGAACTGGG + Intronic
953804213 3:46054044-46054066 TATGTAACCCACATGGACCTAGG + Intergenic
953846754 3:46433570-46433592 TATGTAACCCACATGGACCTAGG - Intergenic
956827197 3:73008510-73008532 ATGCTAACTCACATGCAATTAGG - Intronic
956931617 3:74050021-74050043 CTGGGCACTCACATGGAAATAGG - Intergenic
959010533 3:101070562-101070584 TTTGTAGCTCCCATGGAATTAGG - Intergenic
961608912 3:128121031-128121053 TTGGTAACTGAAGTGGAAATGGG - Intronic
970827324 4:20291784-20291806 TTGGAAACTACCATGGCACTCGG - Intronic
974220441 4:58962519-58962541 TTGGTAACTCACATAAAACTAGG - Intergenic
974517239 4:62933348-62933370 TTGGTGACTAATATTGAACTTGG + Intergenic
976669286 4:87634202-87634224 ATGTTAAAGCACATGGAACTTGG - Intergenic
976708216 4:88041222-88041244 TTGGTAACTGATTTGGAAGTTGG - Intronic
976972455 4:91122090-91122112 TTGGTACCTGACATGGAATATGG + Intronic
977946287 4:102918320-102918342 TTGGTAACTTGCATGTTACTAGG - Intronic
981982792 4:150815312-150815334 TTGGTAATTCATTTGGAGCTGGG - Intronic
983921904 4:173355196-173355218 TTTGTAACATACATGAAACTTGG - Intergenic
983942288 4:173547673-173547695 TTGTAAACAGACATGGAACTAGG - Intergenic
985406225 4:189641013-189641035 TTGTGGACTCACATGGATCTTGG - Intergenic
985935376 5:3093508-3093530 TTGCTAGCTCACAAGGAATTCGG + Intergenic
987742149 5:21923739-21923761 TAGGTAACTCATATGGATCTTGG + Intronic
987844589 5:23266075-23266097 TTTTTATCTCACATGGAACATGG + Intergenic
989665088 5:43844842-43844864 TTTATAATTCCCATGGAACTTGG - Intergenic
990273108 5:54167062-54167084 CTTATAACTCACAAGGAACTGGG - Intronic
990770855 5:59243286-59243308 TTTGTCTCTCATATGGAACTGGG + Intronic
990905967 5:60803292-60803314 TGGGTAGCTCACATGGAAGAAGG + Intronic
994244698 5:97466666-97466688 TTGGTTACTCACCTGGAAAGAGG + Intergenic
997141915 5:131390728-131390750 TTTGTAATTCACAAGGCACTTGG - Intronic
999608911 5:153348280-153348302 TAGCTAACTCACATGGCAGTTGG - Intergenic
999932785 5:156451842-156451864 TTGTTATCTAACATGGAACCAGG - Intronic
1002023647 5:176382521-176382543 CTGGTCACTCACCTGGCACTGGG + Intronic
1007717320 6:43864832-43864854 ATGGTAACTCAGGTGGAACTGGG + Intergenic
1009689869 6:67015934-67015956 TTGGTTACTTACAAGGAATTGGG - Intergenic
1015039413 6:128698741-128698763 TTGGTAACTAAAAAGGAATTGGG - Intergenic
1015483839 6:133745967-133745989 TTGGTGACTCACCTGGAGCAGGG + Intergenic
1015552168 6:134423056-134423078 TAGGGAACTCAGATGGAAGTGGG + Intergenic
1015839650 6:137463254-137463276 TTGGCCAATCACTTGGAACTTGG + Intergenic
1016818397 6:148324854-148324876 CTGCTAACTCACCCGGAACTGGG + Intronic
1021932416 7:25594970-25594992 TTTGAAACTCAAATTGAACTGGG + Intergenic
1022537749 7:31108360-31108382 TTGGTGACTCAGATTGATCTTGG + Exonic
1022649820 7:32264459-32264481 TTTTTAAGTCAGATGGAACTAGG - Intronic
1024255990 7:47540373-47540395 TTGGAAACCCAGCTGGAACTAGG + Intronic
1024620585 7:51154077-51154099 TTGGTGACTCTCAGGGTACTTGG - Intronic
1029654694 7:101916545-101916567 TTGCTAACTGACATGGGACAGGG - Intronic
1031105493 7:117536991-117537013 TTGGTAACTCACATGGAACTGGG + Intronic
1032895259 7:136243273-136243295 TTGATAATTCACCAGGAACTTGG + Intergenic
1033177457 7:139138195-139138217 TGGGTAACTCAGATTGACCTCGG - Intronic
1033773090 7:144575695-144575717 TTCATAACTGAAATGGAACTAGG - Intronic
1033800125 7:144891288-144891310 TTGGTTATTCCCATGGAACATGG + Intergenic
1036442928 8:8797353-8797375 TTGAGAACTCACTTGGAACAGGG + Exonic
1036790289 8:11713245-11713267 GTCGTAGCTCATATGGAACTTGG - Intronic
1037101570 8:15053589-15053611 TTAGTAAATCTCATGAAACTCGG - Intronic
1038287717 8:26220479-26220501 TTGAAGACTCACTTGGAACTGGG - Intergenic
1039863290 8:41478077-41478099 TTGGTAGCTCACATCTACCTTGG - Intergenic
1048323312 8:133418723-133418745 TAGGAAGATCACATGGAACTGGG - Intergenic
1049187845 8:141267949-141267971 TTGGTAAATACCAAGGAACTTGG - Intronic
1049502008 8:142971932-142971954 ATGGTAGATCAAATGGAACTGGG - Intergenic
1051328717 9:16000665-16000687 TTGGTAAGTCACAAGGAAATAGG - Intronic
1052475502 9:28954695-28954717 TTGGGAACTCCCATGGTACACGG + Intergenic
1053594788 9:39548831-39548853 TTGTTAACTCACTTTGAAATAGG + Intergenic
1053852572 9:42303864-42303886 TTGTTAACTCACTTTGAAATAGG + Intergenic
1054571466 9:66816136-66816158 TTGTTAACTCACTTTGAAATAGG - Intergenic
1058930730 9:109716433-109716455 TTGGAAATTCACTTGTAACTGGG - Intronic
1203657309 Un_KI270753v1:10427-10449 TTGTGGACTCACATGGATCTTGG - Intergenic
1186808165 X:13160901-13160923 TTGGTAACTCATCTGGAATTAGG + Intergenic
1186842586 X:13499161-13499183 TGTGTAACTCCCATGGGACTCGG - Intergenic
1189248768 X:39583672-39583694 TTGGTTACTCAGAGGGTACTGGG + Intergenic
1194296708 X:92134767-92134789 TTGTTAACTGTCATGGCACTGGG + Intronic
1194567645 X:95512609-95512631 TTGGTTGCTTACATGGAAGTAGG - Intergenic
1195128878 X:101835941-101835963 ATGGAAACTCACATGCAATTTGG - Intronic
1195177404 X:102323909-102323931 ATGGAAACTCACATGCAATTTGG + Intronic
1195181460 X:102363184-102363206 ATGGAAACTCACATGCAATTTGG - Intronic
1200614223 Y:5359345-5359367 TTGTTAACTGTCATGGCACTGGG + Intronic
1201181991 Y:11357717-11357739 TTGGTAACTTGCATGTTACTAGG - Intergenic
1201711404 Y:16996913-16996935 TTGGTACATCACATGGAAAGAGG + Intergenic