ID: 1031105688

View in Genome Browser
Species Human (GRCh38)
Location 7:117539557-117539579
Sequence ACATATAAGCTACAGAGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 256}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031105688 Original CRISPR ACATATAAGCTACAGAGAAG TGG (reversed) Intronic
901179965 1:7335080-7335102 ACCTATATACTACGGAGAAGAGG + Intronic
901725656 1:11239998-11240020 CCATCTCAGCTACAAAGAAGTGG + Intronic
902094302 1:13930049-13930071 CTATATAATATACAGAGAAGGGG - Intergenic
904235392 1:29113229-29113251 ACAGTAAAGCTGCAGAGAAGAGG + Intronic
907080698 1:51618664-51618686 GTATATAAGCTCCAGAGAAGAGG - Intronic
908264414 1:62364142-62364164 AATAATAAGCTACAGAGATGAGG + Intergenic
910846593 1:91610287-91610309 ACATATTAGGAACAGAGATGTGG - Intergenic
912892789 1:113553008-113553030 ACATAGAAGCCACCTAGAAGGGG + Intronic
913781119 1:122388394-122388416 ACATAAAAACTAGAGAGAAGCGG + Intergenic
913933925 1:125015231-125015253 ACATAAAAACTAGACAGAAGAGG + Intergenic
914912704 1:151800400-151800422 ACCCACAGGCTACAGAGAAGAGG - Exonic
915075720 1:153306983-153307005 AAATAAGAGCCACAGAGAAGGGG + Intronic
915522918 1:156458355-156458377 GAACATGAGCTACAGAGAAGTGG + Intergenic
916311226 1:163400808-163400830 ACATATAAGTCACTAAGAAGAGG + Intergenic
917416736 1:174818367-174818389 ATGTATAAGGTACTGAGAAGTGG + Intronic
917652368 1:177090720-177090742 ACATTGAAGCCTCAGAGAAGAGG - Intronic
919439982 1:197620793-197620815 ACACATAAGCTCCATAGAAACGG - Intronic
919905714 1:202076955-202076977 AAATAGAAGCTGGAGAGAAGAGG + Intergenic
920195880 1:204226766-204226788 AGATTTTAGCTACAGAAAAGAGG - Intronic
921949909 1:220918725-220918747 TCATATAAGCTGCAGATAGGTGG - Intergenic
924716103 1:246575792-246575814 ATATGTAAAATACAGAGAAGTGG + Intronic
1063454448 10:6173373-6173395 ACATAAAAGCTGCACACAAGTGG - Intronic
1064950975 10:20849763-20849785 AAATATAAACTAAAGAGAAAAGG + Intronic
1065191032 10:23209276-23209298 ACATTTAAGACACAGAGCAGGGG + Intronic
1066820711 10:39484280-39484302 ACATAAAAACTACACAGAATAGG - Intergenic
1067664541 10:48265423-48265445 ACAGACAACCTACAGAGTAGGGG + Intronic
1068463186 10:57353460-57353482 ACATTTAAGCTAAAAAAAAGAGG - Intergenic
1069377420 10:67807422-67807444 AAATAAAATCTACAGAGAAATGG - Intronic
1072123409 10:92424426-92424448 TCATATAAGATACCTAGAAGAGG - Intergenic
1072329366 10:94331588-94331610 ATATATAAGCAACTGAAAAGGGG - Exonic
1073333747 10:102688974-102688996 ATATATGAGATACAGACAAGTGG - Intronic
1081336634 11:41874769-41874791 AAATAAAAGAAACAGAGAAGTGG + Intergenic
1083463457 11:62830859-62830881 TGCTATAAGCAACAGAGAAGAGG - Intronic
1087339422 11:96883979-96884001 AGATATACACTACAGAGAAACGG + Intergenic
1087745193 11:101936360-101936382 ACATATAAGCAACAAACAATGGG - Intronic
1088679707 11:112228519-112228541 AAATATAAGGAACAGAGAAGGGG + Intronic
1089739296 11:120571403-120571425 ACATGTAAGCTACAGAAAACGGG - Intronic
1090208975 11:124902426-124902448 ACAAATAAGCAATAGAAAAGTGG - Intergenic
1090856873 11:130617495-130617517 ACATATCCCCTACAGATAAGGGG + Intergenic
1092454436 12:8630086-8630108 ACATATAAGACATAGAGTAGTGG + Intergenic
1095696126 12:45146177-45146199 TCATAGAAGATACAGAAAAGAGG - Intergenic
1096333114 12:50732075-50732097 ACATCTAAGGTACAGAAATGAGG + Intronic
1097449110 12:59714280-59714302 CCATATAAACAAAAGAGAAGAGG + Intronic
1097606610 12:61762562-61762584 GCATATAAGCTGCAAAGAAGTGG + Intronic
1100013204 12:89978099-89978121 ATATAAAAGATACAGAGAGGAGG + Intergenic
1100271208 12:93026746-93026768 ACCTATTAACTACAGAGACGTGG + Intergenic
1100878598 12:98991318-98991340 GCATATAGGGTACACAGAAGGGG + Intronic
1102828225 12:115969089-115969111 ACATATCATCTAGAGGGAAGGGG + Exonic
1103457556 12:121078019-121078041 ACCCATAAGCTATATAGAAGTGG - Intergenic
1104233082 12:126904252-126904274 AGAAATAAGATCCAGAGAAGGGG - Intergenic
1105775573 13:23656800-23656822 AAATAGCAGCCACAGAGAAGGGG - Intronic
1106010441 13:25815914-25815936 AAATATAAGCTACACAGACAAGG + Intronic
1106296851 13:28422057-28422079 ACATAAATGCTAAAGACAAGTGG + Intronic
1106954108 13:34916518-34916540 ACATAGAAGCTAGGGAGAGGAGG + Intergenic
1107922759 13:45227495-45227517 ACATATAAGCTGTAGATAAAGGG - Intronic
1114230364 14:20776127-20776149 AATTAGAAGCTACAGGGAAGTGG - Intergenic
1114755207 14:25252035-25252057 ACAAATATGCTACAAAGAGGAGG - Intergenic
1115302728 14:31902589-31902611 AAAGGTAAGCTACAGAGTAGGGG + Intergenic
1115589541 14:34850721-34850743 AGATACTTGCTACAGAGAAGTGG - Intronic
1116608028 14:47028028-47028050 AGATCTTAACTACAGAGAAGAGG + Intronic
1116791144 14:49341688-49341710 ACAGTAAAGGTACAGAGAAGTGG + Intergenic
1118547791 14:66913041-66913063 ATATATCAGCAACAGAGAGGAGG + Intronic
1120932539 14:89864000-89864022 ATAAATAAGCTTGAGAGAAGTGG - Intronic
1122419986 14:101569778-101569800 GCAAATAATCTACAGATAAGTGG - Intergenic
1124898792 15:33802991-33803013 ATATATAAGCTGCAGACAAGGGG + Intronic
1125296037 15:38204126-38204148 AAATATAAGGTCTAGAGAAGCGG + Intergenic
1125441399 15:39707653-39707675 ATATATAAGGTACTTAGAAGAGG - Intronic
1125958247 15:43806340-43806362 ACAGAAAAGTTAAAGAGAAGAGG - Intronic
1125978269 15:43975442-43975464 ATATAAAAGCAATAGAGAAGAGG + Intronic
1126101915 15:45123140-45123162 AAATGTGAGCTCCAGAGAAGAGG - Intronic
1127218003 15:56845249-56845271 ACATAAAAGAAAAAGAGAAGGGG - Intronic
1130314622 15:82784626-82784648 CCATGGAAGATACAGAGAAGTGG - Intronic
1130397386 15:83514766-83514788 ACATTTAAGCAAAGGAGAAGTGG + Intronic
1130409646 15:83634177-83634199 ACATTTCAGCTAGGGAGAAGAGG + Intergenic
1130431223 15:83849119-83849141 ACATATAAGATGGAGAGAAAAGG - Intronic
1131009858 15:89008214-89008236 ACAGAGAAGATACAGAGAAGGGG - Intergenic
1131070796 15:89464477-89464499 GTATATCAGTTACAGAGAAGGGG - Intergenic
1138254330 16:55540729-55540751 ACATATCCCCTACAGATAAGGGG - Intronic
1138712824 16:58987994-58988016 ACACCTAGGCTACAGTGAAGTGG + Intergenic
1138796227 16:59972465-59972487 ATATATGAGAAACAGAGAAGGGG + Intergenic
1139240939 16:65391573-65391595 ACATATTCCCTACAGATAAGGGG + Intergenic
1140536673 16:75715997-75716019 ACATATAAGAAACAGAAATGTGG - Intronic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1142109436 16:88323426-88323448 ACACAAATGCTACAGAGAAGTGG - Intergenic
1142744313 17:1948110-1948132 ACATATCAGATGCCGAGAAGGGG + Intronic
1143298910 17:5894618-5894640 ACATATAAGTTTCAGACATGAGG - Intronic
1143916888 17:10300806-10300828 AAATATCAGCTTCATAGAAGAGG + Exonic
1144428078 17:15163818-15163840 AAATAAAAGCTAAAGAGAAAAGG + Intergenic
1144461447 17:15461773-15461795 AAATATAGGCTACAGATAAAAGG + Intronic
1145783038 17:27576244-27576266 ACATATCCCCTACAGAAAAGGGG - Intronic
1147519081 17:41151420-41151442 ATATATAAGGTACCCAGAAGTGG + Intergenic
1147942781 17:44061448-44061470 ACCTATAAGCTTCAAAGAATGGG + Intronic
1148008505 17:44454804-44454826 AAATATAAACTATAGAGAAGAGG - Intronic
1148251379 17:46083930-46083952 AAATACAAGCTGCAGAAAAGGGG + Intronic
1148376066 17:47147464-47147486 AAATATAATCTACAATGAAGAGG + Intronic
1150122062 17:62612275-62612297 AAATATCAACTAAAGAGAAGGGG - Intronic
1152788958 17:82267903-82267925 CTTTATCAGCTACAGAGAAGTGG - Intronic
1153534108 18:6082362-6082384 AAATATAAACTATAGAAAAGTGG + Intronic
1155408745 18:25518621-25518643 ACATATACCCTACTGATAAGGGG - Intergenic
1155754233 18:29470495-29470517 CCATAGAGGCGACAGAGAAGTGG - Intergenic
1158453623 18:57587803-57587825 ATATTTAAGCTACAGAAAACTGG - Intergenic
1165016626 19:32885967-32885989 AAATAGAAGGGACAGAGAAGCGG - Intronic
1166407465 19:42531206-42531228 ACATATAAGGTACAGTGATAAGG - Intronic
1168384228 19:55949617-55949639 ACATAGACCCTGCAGAGAAGGGG + Intronic
926618007 2:15018352-15018374 ACATATAAGGTACAGTGATCAGG - Intergenic
926846225 2:17143416-17143438 ACATATTCCCTGCAGAGAAGAGG - Intergenic
927110445 2:19860653-19860675 ACATACAAGCTGGAGAGAATGGG + Intergenic
927308725 2:21603898-21603920 ACATTTAAGCAACACATAAGAGG + Intergenic
927884552 2:26710474-26710496 ACACACAGGCTTCAGAGAAGAGG + Intronic
928581842 2:32716009-32716031 AAATATAAGCAATATAGAAGTGG + Intronic
929154152 2:38774348-38774370 GTAAATAAGCTACAGAGAATGGG - Intronic
929710164 2:44258416-44258438 ACATAGAAGCAAGAGAGAGGGGG - Intergenic
930253814 2:49065956-49065978 ACATATAAGGTAAGTAGAAGAGG + Intronic
930617033 2:53604331-53604353 GAATTCAAGCTACAGAGAAGAGG - Intronic
931027576 2:58130182-58130204 TGATATAAGCTACACACAAGAGG - Intronic
931851544 2:66256147-66256169 AGATTTAAGCTACAGATAAAGGG - Intergenic
932210651 2:69926832-69926854 ACATATAAGCTACAGCCAATAGG + Intronic
936833614 2:116680183-116680205 AAACATAAGATACAGAGTAGTGG + Intergenic
937567436 2:123311780-123311802 ACAGCTAAACTACAGAGAAGTGG - Intergenic
941671878 2:168302507-168302529 ACAGATAGGCTACAGAGAATTGG + Intergenic
941900431 2:170672740-170672762 ACAGGGAAGCTAGAGAGAAGAGG - Intergenic
943108477 2:183576575-183576597 ACATGTAAAATATAGAGAAGTGG - Intergenic
944161074 2:196660738-196660760 AAAGATAAGCTATAGAGCAGGGG - Intronic
946271162 2:218595510-218595532 CCACCTAAGCTCCAGAGAAGAGG - Exonic
946800897 2:223415096-223415118 ACATGTAGGTTACAGAGAAAGGG + Intergenic
948081402 2:235208051-235208073 ACACCTAAGCTAAAGACAAGGGG - Intergenic
949015345 2:241706236-241706258 ACATTTAAGATTCAGGGAAGAGG - Intronic
1169705919 20:8504615-8504637 AAATATAAGCGAAAGAGGAGGGG - Intronic
1170697250 20:18670053-18670075 AAATCCAAGCTAGAGAGAAGAGG - Intronic
1174517001 20:51100345-51100367 AAGTGTGAGCTACAGAGAAGCGG + Intergenic
1177149750 21:17443581-17443603 AAATAGAGGATACAGAGAAGAGG - Intronic
1177936808 21:27358432-27358454 AGATATAAGTTTCAGGGAAGTGG + Intergenic
1178055634 21:28795576-28795598 AGATAAAAGGTACAGAAAAGAGG + Intergenic
1179346623 21:40564415-40564437 ACAAAGAAGCTAGAGGGAAGAGG + Intronic
1180730790 22:17980600-17980622 ACTTATAGGCTTCAGAAAAGAGG - Intronic
1181140359 22:20800148-20800170 ACATTTACGTTACAGAGAAAAGG + Intronic
1181527211 22:23496859-23496881 CCATACAAGATAAAGAGAAGAGG - Intergenic
1182581278 22:31313346-31313368 TCATTTAAGTTACAGAGAACCGG - Intergenic
950328845 3:12139571-12139593 ACGTATAAGATACAGAGAAAGGG - Intronic
950767900 3:15287148-15287170 ACATATAAAGTGCAGAGAAAAGG + Intronic
951123421 3:18956224-18956246 ACATATGAGATACAGTGGAGTGG - Intergenic
951457777 3:22912040-22912062 ACAAACAAACTATAGAGAAGAGG + Intergenic
951546827 3:23834455-23834477 ACAGAAAAGCTACAGAGTAATGG - Intronic
952081828 3:29768382-29768404 ATATATAAGACAGAGAGAAGAGG + Intronic
952162818 3:30711760-30711782 ACATTTAAGCCAAAGAGAACTGG - Intergenic
953320792 3:41969470-41969492 AAAGATAAACTACAGAGAATGGG - Intergenic
953742229 3:45547734-45547756 AAATATGAGCTACTGAGGAGGGG + Exonic
954867686 3:53743830-53743852 CCCTCTAAGCTAAAGAGAAGTGG + Intronic
955052034 3:55422120-55422142 AGACATTAGTTACAGAGAAGGGG + Intergenic
957509935 3:81174519-81174541 ACATATATGTTACAGATAATGGG - Intergenic
957745954 3:84342741-84342763 ATATATAATTTACAGATAAGTGG - Intergenic
957956025 3:87188367-87188389 ACATATATCCAACATAGAAGAGG - Intergenic
959874758 3:111369650-111369672 ACATATTACCCACAGATAAGTGG - Intronic
960290814 3:115882164-115882186 ACCTATAAGCAGGAGAGAAGTGG - Intronic
960514840 3:118592052-118592074 ACATATTAGCTAAAGATAAAGGG + Intergenic
964461443 3:156934680-156934702 ACATAGAAAATACAGAAAAGGGG + Intronic
964937329 3:162106475-162106497 AAATACATGCTACAGAGAAAGGG + Intergenic
965488303 3:169306367-169306389 ACATATAAAATAGAAAGAAGTGG + Intronic
965637795 3:170801924-170801946 ACATACAAAGTACAAAGAAGAGG + Intronic
966961614 3:184945573-184945595 ACATATAAGAGACAGAGAAGAGG - Intronic
970295283 4:14623182-14623204 AAGTATATGCTACAAAGAAGGGG + Intergenic
970892548 4:21064284-21064306 ACATATATTATACAGACAAGTGG + Intronic
974495577 4:62622716-62622738 TCATATAAAATACAGAGATGCGG - Intergenic
974782996 4:66578250-66578272 ACAGAAAACCTAAAGAGAAGAGG - Intergenic
975174480 4:71271628-71271650 AAAAACATGCTACAGAGAAGTGG + Intronic
975310075 4:72893971-72893993 AATTTTCAGCTACAGAGAAGGGG + Intergenic
975491757 4:74996689-74996711 ACATAAAAACTACAGAGCAAAGG - Intronic
976024743 4:80673891-80673913 ACACATAAGCTAAAAAGAAAGGG - Intronic
976564444 4:86537722-86537744 ACATATAACCTAGAAAGGAGTGG - Intronic
980532046 4:134069228-134069250 TAAAATAAGCTAGAGAGAAGGGG - Intergenic
982779441 4:159475378-159475400 ACATATAATATACATAAAAGTGG + Intergenic
983632057 4:169859624-169859646 ACATATAAACAACAGTGAGGTGG - Intergenic
983790970 4:171796335-171796357 ACATATAAGCTCCAGAAAATAGG - Intergenic
984480422 4:180293917-180293939 ACTTTTAAGTTTCAGAGAAGTGG + Intergenic
984878668 4:184391341-184391363 ACAAATAAGATACAGCAAAGGGG + Intronic
984989563 4:185366501-185366523 ACATATAAACTTCAAAAAAGTGG - Exonic
985142019 4:186850168-186850190 ACAAATAAGTGAGAGAGAAGAGG + Intergenic
985147642 4:186910120-186910142 ACCTTTAACATACAGAGAAGTGG - Intergenic
985597638 5:803331-803353 ACAAACAAGCTACAAACAAGGGG - Intronic
986140172 5:5022273-5022295 ACATATGAGCCCCAGAAAAGGGG + Intergenic
987009757 5:13750148-13750170 ACAGAAAAGGTACAGACAAGGGG + Intronic
987570814 5:19655143-19655165 ACACATATGCTACAGAGGAAGGG - Intronic
988109012 5:26791151-26791173 ACATAAGAGCTAAAGAGAGGGGG - Intergenic
988133198 5:27133957-27133979 AAAAATAAGGTACAGAGAACAGG + Intergenic
989887792 5:46916975-46916997 ACATACAAACTAGACAGAAGCGG + Intergenic
990541320 5:56775813-56775835 ACATATAAGATACATAAAAATGG + Intergenic
990633870 5:57700713-57700735 ACATTCAAGCAACATAGAAGGGG + Intergenic
993876170 5:93309863-93309885 ACATATATGCTGCAGAGTTGAGG + Intergenic
994148678 5:96423153-96423175 TCATATAAGCTAGTGGGAAGTGG + Intronic
995241779 5:109893148-109893170 ACATATAAGTTGCATATAAGTGG + Intergenic
995548640 5:113257638-113257660 ATAAATAAGCTACGGATAAGAGG + Intronic
998473866 5:142404694-142404716 ACAGCTAAGAAACAGAGAAGAGG + Intergenic
998790596 5:145762721-145762743 ACATTTAAGCAACAAAAAAGGGG + Intronic
998915911 5:147011117-147011139 ACATATAAAATACAGTAAAGAGG - Intronic
1000006766 5:157192667-157192689 ACATATAAAACAGAGAGAAGTGG + Intronic
1000892570 5:166816862-166816884 TCATATAAGTTAAAAAGAAGTGG - Intergenic
1001853921 5:174994507-174994529 AAATATAGGATACAGAGGAGGGG + Intergenic
1003292341 6:4789958-4789980 ACAAATAACCCACAGGGAAGGGG - Intronic
1004905246 6:20231822-20231844 ACATAAAAACTATAGAGAAGAGG + Intergenic
1007183636 6:39949134-39949156 AAATTTAAGCTAAAAAGAAGAGG - Intergenic
1012679517 6:102161778-102161800 ACATATAGGATAATGAGAAGAGG + Intergenic
1013541467 6:111114722-111114744 AAAAATAAACTACAGAGATGAGG - Intronic
1014428039 6:121333413-121333435 AAATATAAGAGACAGAGAAGGGG - Intronic
1014461325 6:121699234-121699256 ATTTATAAGCAACAGAGCAGGGG + Intergenic
1015127335 6:129769273-129769295 ACTGAAAAGCTACAGAGAAGGGG - Intergenic
1016598083 6:145824096-145824118 ATAAATAATCTACTGAGAAGAGG + Intergenic
1021818188 7:24468856-24468878 AAAGATGAGCTACAGAGTAGGGG - Intergenic
1022221538 7:28319002-28319024 ACATTTAACATACAGATAAGCGG - Intronic
1022490100 7:30810525-30810547 ACATATTAGCTACAGTTAAAGGG + Intronic
1022736487 7:33081017-33081039 ACATATAAGGCACAGAGGGGTGG + Intergenic
1024089693 7:45924945-45924967 AGATAGATGCTCCAGAGAAGGGG + Intergenic
1025963970 7:66250586-66250608 ACATATCATCTGCAGATAAGGGG - Intronic
1026373446 7:69725404-69725426 ACACATTAGGTACACAGAAGAGG + Intronic
1026695428 7:72587083-72587105 ACTTACAAGCCACAGAGCAGGGG + Intronic
1027668984 7:81072978-81073000 ACATATGAGCTACAAAGTGGAGG - Intergenic
1028068592 7:86420176-86420198 GCACATATGCTACAGAGAATGGG - Intergenic
1028325102 7:89513982-89514004 ACTTATAAGCTACAGTCAGGTGG - Intergenic
1028857369 7:95606926-95606948 ACAGATAACCTACAGAATAGGGG - Intergenic
1029138738 7:98394455-98394477 ACATACACCCTACAGAGAAACGG + Intronic
1029863967 7:103605454-103605476 AAATATAAAGTCCAGAGAAGTGG + Intronic
1030920357 7:115377200-115377222 ACATATAAGCAACAAGCAAGGGG - Intergenic
1031105688 7:117539557-117539579 ACATATAAGCTACAGAGAAGTGG - Intronic
1034356902 7:150458040-150458062 ACATCTAAGCAAGACAGAAGTGG - Intronic
1036600994 8:10259974-10259996 ACACAGACGCTCCAGAGAAGAGG + Intronic
1037143489 8:15545693-15545715 ACACATAGGGCACAGAGAAGGGG + Intronic
1037537813 8:19843217-19843239 ATATATTAGCTACAAAGAAAGGG + Intronic
1037716117 8:21402105-21402127 ACATATAGGATATAGAGAAAAGG - Intergenic
1038202056 8:25422068-25422090 ATGTATAACCTGCAGAGAAGAGG + Intronic
1038410267 8:27353056-27353078 ACCTAAAGGATACAGAGAAGTGG + Intronic
1039796569 8:40920442-40920464 AGATACAGCCTACAGAGAAGAGG - Intergenic
1040956622 8:52986426-52986448 ACATAAATGCTCCAGAGAGGAGG - Intergenic
1041417965 8:57634495-57634517 CAATATATGCTACAGAGAATAGG - Intergenic
1041655823 8:60349726-60349748 GCATCTGAGCTAAAGAGAAGAGG + Intergenic
1041798097 8:61768422-61768444 CCAGATCAGCTACAGACAAGAGG + Intergenic
1041882095 8:62763429-62763451 ACAAGAAAGCTACAGGGAAGTGG + Intronic
1043933421 8:86116204-86116226 ACACATAAGAAACTGAGAAGTGG - Intronic
1044514443 8:93121887-93121909 ACATCAAAGCTACAGATAACAGG - Intergenic
1049344616 8:142131850-142131872 CCAAACAAGCTAAAGAGAAGAGG + Intergenic
1050049004 9:1578401-1578423 ACATAGAAGATACTGGGAAGAGG - Intergenic
1050380688 9:5025091-5025113 TCATATAAACTACAGAAAATAGG - Intronic
1050702072 9:8351867-8351889 ACATTTCATCAACAGAGAAGGGG + Intronic
1051463584 9:17352179-17352201 AAATGTAAGCTACAGATCAGTGG + Intronic
1051527392 9:18061734-18061756 ATTTATAAGAGACAGAGAAGTGG - Intergenic
1052375770 9:27716190-27716212 ACATCTAAGCTAGAGTGAAGTGG + Intergenic
1052384119 9:27805252-27805274 GCATAAAACCTACAGAAAAGGGG + Intergenic
1052419765 9:28227515-28227537 ACATACCAGCCACATAGAAGGGG - Intronic
1053716863 9:40905773-40905795 ACATTTAAGCTACGGGGAGGGGG - Intergenic
1054711069 9:68511324-68511346 ACAGCTAAGCTCCAGAGAGGAGG + Intronic
1055719718 9:79158315-79158337 ACATATAGTTTACAGACAAGTGG + Intergenic
1058804880 9:108581143-108581165 GTATATAAGGTACAGAGAATGGG + Intergenic
1060394781 9:123308091-123308113 ACATATTCTCTACAGATAAGGGG - Intergenic
1060626927 9:125122264-125122286 AGATATAAGTTAAAAAGAAGAGG - Intronic
1061158104 9:128877303-128877325 ACACAGAAGCTTCAGAGAGGAGG - Intronic
1061259483 9:129471958-129471980 CCATACAAGATAAAGAGAAGAGG + Intergenic
1061344639 9:130013088-130013110 ACATATGATCAACAGAGAATTGG + Intronic
1186493688 X:9995008-9995030 ATATAAAATATACAGAGAAGAGG + Intergenic
1187326138 X:18291025-18291047 AAATATAAGATACAGAAGAGGGG + Intronic
1187346870 X:18473583-18473605 ATATCTCAGCCACAGAGAAGGGG - Intronic
1187538438 X:20165855-20165877 ACATATACGCCACGGATAAGGGG - Intronic
1188002911 X:24998865-24998887 ACATATAAGGTGCATAGAGGGGG + Intergenic
1188067927 X:25684295-25684317 ACAGATGAGCTACTGAGATGGGG - Intergenic
1188158366 X:26769927-26769949 GCTTATAAGCCACAGAGAAGAGG - Intergenic
1188254739 X:27947949-27947971 ACATATAAAATACATAAAAGTGG - Intergenic
1188412957 X:29896505-29896527 ACATATATTTTACAGAGAATCGG + Intronic
1188434690 X:30147568-30147590 ACAAAGAAGCCACAGAGAACAGG - Intergenic
1189855235 X:45216969-45216991 ACATATAAGCTAGAAATAAAGGG + Intergenic
1191578396 X:62732829-62732851 AGATAAAAACTACAAAGAAGTGG - Intergenic
1192013809 X:67305829-67305851 ACATATCACCCACAGATAAGGGG - Intergenic
1193576170 X:83199067-83199089 ACATAAAGACTACTGAGAAGAGG - Intergenic
1194222111 X:91206651-91206673 ACACATAAGCAAGACAGAAGAGG + Intergenic
1195600386 X:106740341-106740363 ACATTTAAGGTACAGAGTACAGG + Intronic
1195956763 X:110339364-110339386 AAATAAAAACTACAGAAAAGTGG + Intronic
1197580702 X:128279771-128279793 ACATATAAGCTATATAAACGGGG - Intergenic
1198687522 X:139243228-139243250 ACAGACAAGCTACAGAAAGGGGG + Intergenic
1199433817 X:147790096-147790118 ACAAAGAAGATACAGGGAAGCGG - Intergenic
1199995685 X:153024302-153024324 ACATATAAGCTCCTAAGAACTGG - Intergenic
1200558632 Y:4670427-4670449 ACACATAAGCAAGACAGAAGAGG + Intergenic