ID: 1031108073

View in Genome Browser
Species Human (GRCh38)
Location 7:117570153-117570175
Sequence CTTCACCTTCATAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031108073 Original CRISPR CTTCACCTTCATAAGGTGGA TGG (reversed) Intronic
900530191 1:3149273-3149295 CTTCATCTTCTTCAGGAGGAAGG - Intronic
900655752 1:3755997-3756019 CTCCACCTTCCTGAGGTTGAGGG - Intronic
903562224 1:24236553-24236575 CTTCACATTCCTAGGGTGGAGGG + Intergenic
903767906 1:25746707-25746729 CTTCAGCTCCATGAGGTAGAGGG - Exonic
905929378 1:41776529-41776551 CTTCACCTGCATAAGGACAAAGG - Intronic
907180491 1:52565483-52565505 CTGCACCTTCACATGGTGAAAGG - Intergenic
908413158 1:63886632-63886654 CTTCTCCTTCAGAATGTTGAAGG + Intronic
908659126 1:66419125-66419147 CTTTTCCTTCATAAGAGGGATGG + Intergenic
909557780 1:76973465-76973487 ATTAACCTTCATAAGGTAGATGG - Intronic
912052564 1:105548455-105548477 CTTTACATTCACAAGGTGCATGG + Intergenic
916305613 1:163327207-163327229 CTTCTATTTCCTAAGGTGGATGG + Intronic
919615644 1:199805517-199805539 CTTCACATTCGTAAGGTGTCTGG - Intergenic
920785693 1:209039043-209039065 CTTTAGATTCATATGGTGGAAGG + Intergenic
1064155161 10:12897842-12897864 CTTCACCTGCCTCAGCTGGAAGG + Exonic
1064387411 10:14909036-14909058 CTTCACCTGCAAAAGGCTGATGG - Exonic
1064893104 10:20202383-20202405 TTTCACCTGCATCAGGTGGATGG - Intronic
1067774982 10:49156955-49156977 TTTCTCCTTCAAAAGATGGAAGG + Intronic
1068141813 10:53018851-53018873 ATTAACTTTCATAAAGTGGATGG + Intergenic
1068487750 10:57681283-57681305 CTTTATATTCATAAGGTGGCAGG + Intergenic
1069175081 10:65280239-65280261 CATCTTCTTCATAAGGTGGCAGG - Intergenic
1069185091 10:65412440-65412462 ATTGTCCTTCATAATGTGGATGG + Intergenic
1069587696 10:69619505-69619527 CTGCATCTTCACATGGTGGAAGG + Intergenic
1070644956 10:78195386-78195408 CCTGGCCTTCAGAAGGTGGAAGG + Intergenic
1072589921 10:96819843-96819865 CTGCATCTTCACATGGTGGAAGG + Intergenic
1077420264 11:2446664-2446686 CTTCCCCTTCCTGATGTGGAAGG - Intronic
1081451944 11:43179538-43179560 ATTAACCATCACAAGGTGGAAGG + Intergenic
1081457598 11:43240432-43240454 CTTCACTTTCATGAGGTTGAGGG + Intergenic
1082974257 11:59056928-59056950 CTTCAACTTCATAAAATGAATGG + Intergenic
1082978667 11:59100723-59100745 CTTCAACTTCATAAAATGAATGG + Intergenic
1083329288 11:61890173-61890195 CCTCAGCTTCATGGGGTGGAAGG + Intronic
1083459380 11:62800481-62800503 CTTCAACTGCAAAGGGTGGAAGG + Exonic
1083768670 11:64854405-64854427 CTTGACCTTGATGAGGTGGTTGG + Exonic
1085698971 11:78729506-78729528 GTGCACCTTCATGAGGTTGAAGG + Exonic
1086060841 11:82698467-82698489 CTGCACCTTCATATGGTAGAAGG - Intergenic
1086268402 11:85029008-85029030 CTTCCCCTTCATAAGTTAAAAGG - Intronic
1086485729 11:87299309-87299331 CTTCTTCTTCACAAGGTGGCAGG + Intronic
1087723634 11:101694577-101694599 GTTCAATTTCATTAGGTGGAAGG - Intronic
1091765398 12:3117033-3117055 CTTCACCTTTACAAGCAGGATGG + Intronic
1092293348 12:7178737-7178759 CTGCATCTTCACATGGTGGAAGG - Intergenic
1093683709 12:22031845-22031867 CCGCACCCTCATATGGTGGAAGG - Intergenic
1096110606 12:49027049-49027071 CTTCACCTTCTTCAGGGGGCCGG + Exonic
1096220444 12:49825714-49825736 CTTCACCTTCATAGGCAGCAGGG + Intronic
1096830562 12:54310688-54310710 TTTCACCTTGATAAGGTAGAAGG - Intronic
1098182601 12:67863859-67863881 CTGCATCTTCATATGGCGGAGGG + Intergenic
1099790941 12:87332651-87332673 CTTCATCTTCACATGGTGGAAGG - Intergenic
1099819570 12:87693184-87693206 ATTCTTCTTCATAAGGTGGCAGG + Intergenic
1103347722 12:120262441-120262463 CTTAATCATCATAAGGTGGTAGG - Intronic
1105863934 13:24442197-24442219 CTTCCCCTTCATAAGTTTAAGGG - Intronic
1106058336 13:26260488-26260510 CCTCACCTCCATGAGGTGTAAGG + Intronic
1109916594 13:68995249-68995271 CTTCAAATTCTTAAGATGGAAGG - Intergenic
1110413846 13:75231264-75231286 CTTCTCTTTCTTGAGGTGGAGGG - Intergenic
1112251470 13:97784471-97784493 CTTCATCCTCACATGGTGGAAGG - Intergenic
1113440581 13:110325036-110325058 CTTCACATGCACAAGGAGGATGG + Intronic
1114817512 14:25978039-25978061 CTTTCCCTTCTTGAGGTGGAAGG - Intergenic
1114844191 14:26301192-26301214 CTGCATCTTCATGTGGTGGAAGG - Intergenic
1116678453 14:47936258-47936280 CTTCAGCTTCCTAAAGTGCAAGG - Intergenic
1121632768 14:95433044-95433066 CTTCAGCCTCATGAGGTGGTTGG + Intronic
1126338456 15:47613221-47613243 CTACACCTTCAATTGGTGGAAGG + Intronic
1126648451 15:50898194-50898216 CTGCACCTTCTTAAAGTGTACGG + Intergenic
1127891082 15:63251651-63251673 CTCTACCTTCAAAATGTGGAAGG - Intronic
1128039514 15:64558390-64558412 TTTCAGCTTCATAGGGTGGTTGG + Intronic
1128114380 15:65096133-65096155 CTTCACCTTCAGAAGGAGGGCGG + Intronic
1128177279 15:65566958-65566980 CTTCATCTACACAAGGTGGGAGG - Intronic
1129971113 15:79778876-79778898 ATTTACCTTGAAAAGGTGGAAGG - Intergenic
1132297519 15:100751815-100751837 TTAATCCTTCATAAGGTGGATGG - Intergenic
1133466719 16:6034497-6034519 CTGCATCTTCATATGGTGGAAGG + Intronic
1134476374 16:14577582-14577604 CCTCACCTTCACAAAGTGGTGGG + Intronic
1135647780 16:24178301-24178323 TTTCTGCTTCAAAAGGTGGATGG - Intronic
1136531114 16:30870077-30870099 CTGCATCTTCCTAAGGTGGCAGG - Intronic
1136868215 16:33772909-33772931 CTTCAGCTTCATTATTTGGAAGG - Intergenic
1136957962 16:34805771-34805793 CTTCAGCTTCATTATTTGGAAGG - Intergenic
1138235689 16:55380390-55380412 CTTCTCCTTTCTGAGGTGGAGGG - Intergenic
1138361456 16:56432380-56432402 ATTCACCATCCTAAGGTGGGGGG + Exonic
1141745361 16:85922160-85922182 CTTCATTTTGAGAAGGTGGAAGG + Exonic
1141845638 16:86606846-86606868 CTTCACAATCATAACGTTGAGGG - Intergenic
1203103959 16_KI270728v1_random:1343367-1343389 CTTCAGCTTCATTATTTGGAAGG + Intergenic
1203129555 16_KI270728v1_random:1619001-1619023 CTTCAGCTTCATTATTTGGAAGG - Intergenic
1143351305 17:6290192-6290214 CTACACCCTCACATGGTGGAAGG - Intergenic
1144819092 17:18058948-18058970 CTACGTCTTCATGAGGTGGAAGG + Exonic
1145690486 17:26733618-26733640 CTTCAGCTTCATTATTTGGAAGG - Intergenic
1146292125 17:31616139-31616161 CTTCATCTTCATAATTTGGTTGG - Intergenic
1146672620 17:34752171-34752193 CTTCATCATCACAAGGTAGAAGG + Intergenic
1149278430 17:55072048-55072070 TTTCCTCTTCCTAAGGTGGAAGG + Intronic
1149357387 17:55855517-55855539 CTACATCCACATAAGGTGGAAGG + Intergenic
1150516778 17:65820696-65820718 CTTCAACTTCATAAGGTAGTTGG + Intronic
1150918066 17:69456527-69456549 TGTGACGTTCATAAGGTGGATGG + Intronic
1154083701 18:11281602-11281624 CCTCACCTCCAGAAGGTGTAGGG - Intergenic
1155696283 18:28690768-28690790 CTTCACCTTCAGATGTTAGAGGG - Intergenic
1158093554 18:53744282-53744304 CACCTCCTTCACAAGGTGGAAGG + Intergenic
1159657927 18:71055205-71055227 ATTCACTTTCTGAAGGTGGATGG - Intergenic
1159868824 18:73737554-73737576 CTTCTCCTTCAGTAGGTGAATGG - Intergenic
1164605745 19:29596663-29596685 CTTTTCCTTGATAAGGAGGAGGG + Intergenic
1167344394 19:48936179-48936201 CCTCACCTCCATAAGGAAGAGGG - Exonic
1167587365 19:50382667-50382689 CTTCCTCTTCCTAGGGTGGAAGG + Exonic
926723442 2:15979745-15979767 CTTCAGCTTCCTAAAGTGGTAGG + Intergenic
928104715 2:28461342-28461364 CTTTTCCTTGATAAGGTAGAAGG + Intronic
928653112 2:33422584-33422606 CTGCATCTTCACATGGTGGAAGG - Intergenic
932359290 2:71091324-71091346 CTGCATCCTCATATGGTGGAAGG - Intergenic
935501023 2:103838946-103838968 CTTCAACTTCATAAGGAGAAGGG - Intergenic
936606607 2:113963882-113963904 CTTCACCTCTATAAAGTGGGAGG + Intergenic
937799811 2:126070444-126070466 CTTCACATTGAGAAGGAGGAAGG - Intergenic
937941255 2:127287857-127287879 CTTGATCTTCAAATGGTGGATGG - Intronic
941672265 2:168307706-168307728 CATCACCTTCACAAGAAGGAAGG - Intergenic
941821018 2:169843316-169843338 CTGCATCTTCACATGGTGGAAGG + Intronic
942264704 2:174211018-174211040 CTTCACACTCCTGAGGTGGAAGG + Intronic
943897135 2:193378489-193378511 CTTCACCTGCAGAAGATGTAAGG + Intergenic
944081982 2:195798256-195798278 CTACAACTCCATAAGGTAGATGG - Intronic
946160061 2:217830513-217830535 CCTCTCCTTCTTATGGTGGAGGG - Intronic
947463706 2:230323784-230323806 CCCCACCTTCAGAAGGTGGCCGG + Intergenic
948898466 2:240941949-240941971 CTGCACCTTCACATGGTGGAAGG - Intronic
1172459895 20:35109653-35109675 ATTACCCTTCATAATGTGGATGG - Intergenic
1172744556 20:37196628-37196650 CCTCACCTTCATAAAGTGTTAGG + Intronic
1173201407 20:40957781-40957803 CTCAACCTTCCTAGGGTGGATGG - Intergenic
1173677837 20:44853151-44853173 CTGCATCTTCACATGGTGGAAGG + Intergenic
1177255181 21:18652315-18652337 CTGCATCTTCATATGGTGGAAGG - Intergenic
1177627827 21:23687183-23687205 CCTCTTCTTCATAAGGTGGTGGG + Intergenic
1178441564 21:32602667-32602689 CTGGATCTACATAAGGTGGAGGG + Intronic
1178571855 21:33745592-33745614 CTTCAGCTTGGTAATGTGGAGGG + Intronic
1178751066 21:35303501-35303523 CATCTCCTTCACATGGTGGAAGG + Intronic
1182033239 22:27176568-27176590 CTTCACCAGCATATGGTTGATGG + Intergenic
1183773226 22:39944872-39944894 ATTCACCTTAATAAGCAGGATGG - Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184778126 22:46633380-46633402 CCCCACCTTCATTAGGTGGGGGG - Intronic
1185090962 22:48772925-48772947 CACCACGTTCAGAAGGTGGAAGG - Intronic
950686445 3:14621872-14621894 CTGCACCTTCTTGAGGTGTAGGG + Intergenic
952686241 3:36151816-36151838 CTGCATCCTCATATGGTGGAAGG + Intergenic
952839980 3:37638065-37638087 CTTCACCTCCATAATTTTGATGG - Intronic
952951210 3:38526937-38526959 CTCCACCTTCATGATCTGGACGG + Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
955940797 3:64145820-64145842 CTCCACCTTCATATGGTACAAGG + Intronic
956345474 3:68273183-68273205 CTTCCCCTTCACATGGTTGAAGG - Intronic
956539900 3:70324881-70324903 CTTCTCCATCATGAGTTGGAAGG + Intergenic
956735590 3:72235550-72235572 CTGCACCCTCACATGGTGGAAGG + Intergenic
957926431 3:86819205-86819227 CTTCACCTTGTGAAGGTGCAAGG + Intergenic
958625702 3:96619667-96619689 CTCCACCTTCATGATCTGGATGG - Intergenic
962250939 3:133835790-133835812 CTGCATCCTCACAAGGTGGAAGG - Intronic
962525175 3:136231811-136231833 CTTTGCCTTCATTGGGTGGAAGG - Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
966101204 3:176270467-176270489 CTTCATCTACTCAAGGTGGAAGG - Intergenic
966641375 3:182194527-182194549 CTTCTCCTTAATAAACTGGAAGG + Intergenic
970559063 4:17265182-17265204 CTGCATCCTCACAAGGTGGAAGG + Intergenic
970719331 4:18968015-18968037 CTTCATCGTCATGTGGTGGAAGG - Intergenic
971361957 4:25946398-25946420 CTGCACCCTCACATGGTGGAAGG + Intergenic
971591238 4:28472228-28472250 AGACACCTTCACAAGGTGGAAGG - Intergenic
972110323 4:35550060-35550082 CTTCACCCTCACAAGGTGGAAGG + Intergenic
973208490 4:47587674-47587696 CTGCACCTTCAGATGGTGGAAGG + Intronic
973785313 4:54327060-54327082 CTGCATCTTCATAACGTGTAAGG - Intergenic
978620231 4:110629789-110629811 CTTCACCCTCAGGAGGAGGACGG - Intronic
979002853 4:115247625-115247647 ATTTACCTCCATAATGTGGATGG + Intergenic
979370549 4:119881020-119881042 CTTAACCTCCATAAAGTTGAAGG + Intergenic
979378703 4:119982083-119982105 ATTAACCTCCATAATGTGGATGG + Intergenic
981219846 4:142218890-142218912 CTTCAATTTCATAAAGTGGTTGG + Intronic
983819025 4:172170359-172170381 CAACACCTTCACAAGGTGGCAGG - Intronic
986293157 5:6416486-6416508 TTTCACCTAGAGAAGGTGGAGGG - Intergenic
987969744 5:24927243-24927265 CTCCATCTTCATATAGTGGAAGG - Intergenic
989312745 5:40039448-40039470 CTGCACCATCACATGGTGGAAGG + Intergenic
991092535 5:62706843-62706865 CATCATCTTCATTAGGTGCAGGG + Intergenic
992712613 5:79475186-79475208 CCTCATCTTCAAAAGGGGGATGG - Intronic
993806172 5:92412639-92412661 CTCTATCTTCATAAAGTGGATGG - Intergenic
996426859 5:123322209-123322231 CTACGTCTTCATATGGTGGAAGG - Intergenic
999082491 5:148857327-148857349 CTTGACCTTCATCATGTGGATGG - Intergenic
1001466128 5:171968117-171968139 CTCCACCTTCATTAGGAGAATGG - Intronic
1002650433 5:180687897-180687919 CTGTAGCTTCCTAAGGTGGAAGG - Intergenic
1002972976 6:2043380-2043402 CAACACCTTCATAAGCTGGATGG + Intronic
1003682878 6:8273017-8273039 CTTTACCTCTATAAGGAGGATGG + Intergenic
1007196522 6:40066322-40066344 CCTCACCTTCCCAAGGTGGGTGG - Intergenic
1008367594 6:50700553-50700575 CTGCATCATCATAAGGTGGAGGG - Intergenic
1009902462 6:69824519-69824541 ATTCTCCTTCACAAGGTGGCAGG + Intergenic
1011410710 6:87063098-87063120 CATCATCTTCACAAGGTGGCAGG + Intergenic
1012791117 6:103697202-103697224 CTTCACCATTATAAGCTGTAGGG - Intergenic
1014354246 6:120384684-120384706 CTTAGCCTTCATAAAGTTGAAGG + Intergenic
1014727023 6:124983579-124983601 CTTCACTTTCATAAGGGTGTGGG + Intronic
1015185537 6:130411632-130411654 CTTGACTTTCATAAACTGGAAGG + Intronic
1015375050 6:132500901-132500923 TTTCACCTTGAGAAGGAGGAAGG - Intronic
1016029293 6:139321340-139321362 CTTTATCTTCATATGGTAGAAGG - Intergenic
1016956573 6:149632790-149632812 CTTCTCCCTCAGAAGCTGGAAGG + Exonic
1019693820 7:2433319-2433341 CTTGACCTTCATGAGGTGGCGGG - Exonic
1019883601 7:3884787-3884809 CTTGTCCTTCACAAGTTGGAAGG - Intronic
1020511693 7:9064727-9064749 CTGCATCCTCACAAGGTGGAAGG - Intergenic
1022955967 7:35380652-35380674 CTCCATCTTCAGAAGGTGGAGGG - Intergenic
1024607979 7:51038497-51038519 TTTGACCTTCATAGGGTGCAGGG + Intronic
1025320659 7:58089938-58089960 CTTCAGCTTCATTATTTGGAAGG - Intergenic
1025798184 7:64759238-64759260 CTTTTCCTTCATAATGAGGATGG + Intergenic
1031108073 7:117570153-117570175 CTTCACCTTCATAAGGTGGATGG - Intronic
1031882400 7:127211709-127211731 CTGCATCTTCACAGGGTGGAAGG - Intronic
1032316922 7:130846649-130846671 ATTTCCCTTCATAATGTGGATGG - Intergenic
1032880426 7:136084183-136084205 ATTACCCTTCATAATGTGGACGG - Intergenic
1033672460 7:143505942-143505964 CATCTTCTTCATAAGGTGGCAGG - Intergenic
1036282906 8:7416879-7416901 CAGGACCTTTATAAGGTGGAAGG - Intergenic
1036338562 8:7894639-7894661 CAGGACCTTTATAAGGTGGAAGG + Exonic
1037605570 8:20434875-20434897 CCTCACCTTCGTAGGGAGGATGG - Intergenic
1040744527 8:50625180-50625202 CTTCACCTTCATGTGCTGTAGGG - Intronic
1040825882 8:51620043-51620065 CTTCCCCATCATAAGGGTGATGG - Intronic
1044654253 8:94530984-94531006 CTTCATCATCATCAGGTGGAGGG + Exonic
1044661534 8:94596140-94596162 ATTCAGATTCAGAAGGTGGAAGG + Intergenic
1045022289 8:98054151-98054173 CTTCATCTTCACAAGGCAGAAGG - Intergenic
1046396747 8:113650281-113650303 ATGCACCCTCACAAGGTGGAAGG - Intergenic
1047316646 8:123740981-123741003 TTTCTCCTTCCTCAGGTGGATGG + Intergenic
1048510499 8:135057510-135057532 CACCTCCTTCACAAGGTGGAAGG - Intergenic
1050667257 9:7953649-7953671 CTACATCTTCACAAGGTGGAAGG - Intergenic
1054941582 9:70748643-70748665 CTGCATCTTCATGTGGTGGAGGG - Intronic
1055073805 9:72193877-72193899 CTCCACCTTCAAAAAGGGGAAGG - Intronic
1055611114 9:78025645-78025667 TTTCTCCCTCAGAAGGTGGAGGG - Intronic
1055701434 9:78949113-78949135 ATCCATCTTCATAAGGTGGCAGG - Intergenic
1056268128 9:84920183-84920205 ATTCACATTCATAAGGTGGAGGG + Intronic
1056349914 9:85739761-85739783 CCTCAGCTTCTTAAGGTGCAGGG - Intronic
1056853334 9:90103180-90103202 CTGCACCTTCACATGGTGGAAGG - Intergenic
1057135933 9:92687879-92687901 CTACTCCTTCTTAAGCTGGATGG + Intergenic
1057479088 9:95430057-95430079 ATGCACCTTTGTAAGGTGGATGG - Intergenic
1059470112 9:114498612-114498634 CTTCACCTTACTAAGGTTGGGGG - Intronic
1060731727 9:126041503-126041525 CTGCATCCTCATATGGTGGAAGG - Intergenic
1185717557 X:2354765-2354787 CTTCAGCTGCTTAAGATGGACGG - Intronic
1187762070 X:22598321-22598343 CTGTACCTTCACATGGTGGAAGG - Intergenic
1188272547 X:28158455-28158477 CTTCACCTTCAAAACGAGCATGG + Intergenic
1190737954 X:53268076-53268098 CTACAGTTTCATATGGTGGATGG + Intronic
1192018153 X:67354461-67354483 CTGCATCCTCATATGGTGGAAGG + Intergenic
1192781746 X:74300765-74300787 TTTCAGTTTCTTAAGGTGGATGG - Intergenic
1192824879 X:74684527-74684549 ATTACCCTTCATAATGTGGATGG + Intergenic
1194023517 X:88723428-88723450 CCTTTCCTTCATAAAGTGGATGG - Intergenic
1195949193 X:110249470-110249492 TTTCACCTTCATAAGGTTGTTGG + Intronic
1196080384 X:111624351-111624373 CTCCACCTTCATGATCTGGATGG + Intergenic
1196298463 X:114026646-114026668 CATCAAATTCATATGGTGGAAGG - Intergenic
1198881902 X:141291109-141291131 CTGCATCTTCACATGGTGGAAGG + Intergenic
1199208289 X:145174912-145174934 CTGCGCCCTCATATGGTGGAAGG - Intergenic
1199636101 X:149812483-149812505 CTGCCCCTGCATCAGGTGGAAGG + Intergenic
1200959870 Y:8986796-8986818 CTTTTCCTTCATAAGGAGGGTGG - Intergenic