ID: 1031112713

View in Genome Browser
Species Human (GRCh38)
Location 7:117631132-117631154
Sequence CAAAATCCAAAATTGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 347}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031112713_1031112716 17 Left 1031112713 7:117631132-117631154 CCAACCTCCAATTTTGGATTTTG 0: 1
1: 0
2: 0
3: 24
4: 347
Right 1031112716 7:117631172-117631194 GTCGAAAACTCAGATAATCCAGG 0: 1
1: 0
2: 0
3: 2
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031112713 Original CRISPR CAAAATCCAAAATTGGAGGT TGG (reversed) Intronic
900008390 1:81098-81120 CAAAATTCAAAATTCGGAGTAGG - Intergenic
903448108 1:23435327-23435349 CGACATCAAAAATTGGATGTTGG - Intronic
904585957 1:31580660-31580682 TAAAAGGCAACATTGGAGGTGGG + Intronic
907060640 1:51420125-51420147 CAAAATCCAAAATGTGTGATTGG - Intronic
907111799 1:51933502-51933524 CAACATGTAAATTTGGAGGTGGG - Intronic
908483587 1:64568536-64568558 CCAAATCCCAAATGGGGGGTGGG - Intronic
909275660 1:73683253-73683275 CAAAAGCCAAAATTGGCGAATGG - Intergenic
909735811 1:78960651-78960673 CAACATACAAATTTGGGGGTGGG - Intronic
909904267 1:81176318-81176340 AAAAATGCAAAAGTGGAGGCAGG - Intergenic
910197658 1:84660604-84660626 AAAAATACAAAATTGGCCGTGGG + Intronic
910254354 1:85232562-85232584 CAAAATCAAAAATTGACAGTGGG - Intergenic
910672338 1:89785819-89785841 CAAAATCCAAAATGTGAGCCAGG + Intronic
911454732 1:98108958-98108980 CAAAAGACAAAATTGAAAGTGGG - Intergenic
912810017 1:112786999-112787021 AAAAATACAAAATTAGAGCTCGG + Intergenic
913553041 1:119935701-119935723 CAAAAGCTAAATTAGGAGGTGGG - Intronic
914339252 1:146744398-146744420 TAAGATCCAAAACTGGGGGTGGG + Intergenic
914848964 1:151299994-151300016 CAAAAACCAAAAATTGAGTTTGG + Intronic
916459741 1:165011124-165011146 CAAAATCCAAAAAAGGAGGCAGG + Intergenic
918565666 1:185928141-185928163 CAATATACAAATTTGAAGGTAGG - Intronic
918869477 1:189950248-189950270 CAAAATAAAGAATTTGAGGTAGG + Intergenic
918884023 1:190167111-190167133 CAAAATCCAAAATCGGATAAAGG - Intronic
918929457 1:190835193-190835215 CAACATGCAAATTTGGAGATGGG - Intergenic
918932162 1:190868417-190868439 CACAATGCAAAATTGAAGGAAGG - Intergenic
920462330 1:206150750-206150772 CAATATCCAAACATGGAAGTTGG - Intergenic
920998704 1:211020113-211020135 CCAAATCCAAAATTAGAAGAAGG + Intronic
921008622 1:211118311-211118333 GAAAATACAAATTTGGAGGCAGG - Intronic
923142386 1:231171611-231171633 GAAATTCCAAACTTGGAGGAAGG - Intronic
924136193 1:240969698-240969720 CAAAAACCAAAAATGGAATTAGG + Intronic
924423424 1:243930523-243930545 CAAGATTCAAAGGTGGAGGTTGG - Intergenic
924561883 1:245163544-245163566 CAAAAAAAAAAATTGGAGTTAGG - Intronic
924791886 1:247258435-247258457 CAAAATCAAAAATGGAAGTTGGG - Intergenic
1065066121 10:21966844-21966866 CAAAATACAAAATATGAGCTGGG - Intronic
1065208676 10:23381624-23381646 AGTAGTCCAAAATTGGAGGTGGG + Intergenic
1067260214 10:44683002-44683024 CAAAATGCAAAACTGGACTTAGG - Intergenic
1068321532 10:55424353-55424375 CAAAATTAAAAGTTGGATGTTGG + Intronic
1068409869 10:56640882-56640904 CAAAAGCCAAAATTGCAAATGGG - Intergenic
1068858306 10:61820287-61820309 AAAAATCCAAGATTGGACTTTGG + Intergenic
1072023882 10:91434180-91434202 CAAAAAATAAAATTGAAGGTGGG - Intronic
1074413896 10:113250353-113250375 CAAAATCCAAAACTTGATGTCGG - Intergenic
1074633976 10:115292388-115292410 AAAAATCCAAAATTAGAAGAAGG - Intronic
1074749230 10:116567921-116567943 TAAAATCCAAAATTTGGAGTTGG + Intergenic
1075433262 10:122408964-122408986 GGAAATCCAAAATTAGAGTTTGG + Intronic
1076354803 10:129843919-129843941 CACAATCGTAAACTGGAGGTAGG - Intronic
1077628643 11:3796022-3796044 TAAAAACCAAAACTAGAGGTTGG - Intronic
1078018985 11:7639956-7639978 CACAATCCACAATTGGAGAATGG + Intronic
1078525286 11:12096326-12096348 CAGAGTCCAAAATGGGAGGCAGG + Intronic
1079919683 11:26417432-26417454 CAAGCTCCAAAATTGGGGCTTGG + Intronic
1080533291 11:33197654-33197676 CAAAATTGAAAATTGGGGGTGGG - Intergenic
1080943594 11:36946909-36946931 CAAAACCCACAATGGGAGTTGGG + Intergenic
1083710320 11:64544235-64544257 TAAACTCCAAGAATGGAGGTAGG - Intergenic
1084382427 11:68821447-68821469 CAAAATACAAAAATGTAGGCCGG - Intronic
1086662075 11:89431334-89431356 CAAAAGCCAAAATTGAAAATGGG + Intronic
1086784427 11:90949191-90949213 CAAAATGAACATTTGGAGGTAGG + Intergenic
1087431630 11:98063662-98063684 CAATTTCCAATGTTGGAGGTGGG - Intergenic
1087596606 11:100261927-100261949 CAAAAGCCAAAATTGGAAAATGG + Intronic
1088054365 11:105557252-105557274 CAAAACCTAAAATTGGTGTTTGG - Intergenic
1088198880 11:107308114-107308136 CCAAATCTCAAGTTGGAGGTGGG + Intergenic
1089927554 11:122274610-122274632 CAAAATCCAATTTTAGAGGCAGG - Intergenic
1090035567 11:123246686-123246708 AAAAATCCAAAAATGGAAGGTGG - Intergenic
1090882489 11:130846338-130846360 CAAAGTCCTAAATTGGAAATGGG - Intergenic
1091027004 11:132150312-132150334 TTGATTCCAAAATTGGAGGTGGG - Intronic
1091421078 12:340998-341020 CAAAATTCAATAATGGAGGCAGG + Intronic
1091811050 12:3398226-3398248 TAAAATCCAAATTTCGAGGGAGG - Intronic
1093122594 12:15290864-15290886 CAAAATACAAAAATGGAGGCTGG + Intronic
1093613744 12:21195068-21195090 TAATATCCAATGTTGGAGGTAGG - Intronic
1094203454 12:27816401-27816423 TAATCCCCAAAATTGGAGGTGGG - Intergenic
1097461915 12:59872676-59872698 CAACATACAAAATGGGAGATTGG + Intergenic
1097965250 12:65572443-65572465 CAGAATGGAAAATTGTAGGTGGG - Intergenic
1098478714 12:70937466-70937488 CAAAAGCCAAAATTGTCAGTTGG + Intergenic
1098558980 12:71851318-71851340 CAATACCCAACGTTGGAGGTGGG - Intronic
1098823810 12:75268258-75268280 CAAAATACAAAATTTGGGGCAGG + Intergenic
1098826373 12:75302557-75302579 CAAAAACTAAAATTAGAAGTAGG - Intronic
1099509942 12:83522312-83522334 CAAATTTAAAAATTGGAGATAGG + Intergenic
1099986838 12:89676050-89676072 CAAAATCCAAGCTAGGAGTTTGG + Intronic
1100183441 12:92110115-92110137 CAAAATCTAAGAGTGGAGGCAGG + Intronic
1101183547 12:102248557-102248579 CAAAATCAAAAGTGGGATGTTGG + Intergenic
1101481941 12:105107128-105107150 CAAAAATCCAAATTGCAGGTGGG + Intergenic
1102501131 12:113353348-113353370 AAAAATACAAAATTAGTGGTGGG + Intronic
1103328683 12:120138652-120138674 CAAAAGCCAAACTGGTAGGTAGG + Intronic
1105443259 13:20432517-20432539 CAAAATACAAAGTTGGAATTTGG + Intronic
1106174010 13:27313018-27313040 AAAAATACAAAATTTAAGGTCGG - Intergenic
1107998210 13:45882530-45882552 CAAAATCCAACATGGTACGTGGG + Intergenic
1108588287 13:51890237-51890259 CGATCTCCAATATTGGAGGTGGG + Intergenic
1108734445 13:53268092-53268114 CAAAAGCCAAAATTGGCAGATGG - Intergenic
1108902767 13:55433607-55433629 AAAACTCAAAAATTGGATGTAGG + Intergenic
1109668482 13:65570853-65570875 AAAAATCAAACATAGGAGGTAGG - Intergenic
1109890200 13:68601957-68601979 TAATCTCCAATATTGGAGGTAGG + Intergenic
1110091325 13:71451791-71451813 CAAATGACAAAATTGGAAGTTGG + Intronic
1113139420 13:107130603-107130625 CAACATCCAAATTTGCAGGGAGG - Intergenic
1113461535 13:110485586-110485608 CAAAATTGAAAACTGGAGGGCGG + Intronic
1114540370 14:23451667-23451689 CAAAAGACAAAATTGTAAGTTGG + Intergenic
1114781078 14:25538806-25538828 CCAAATACACAATTGGAAGTAGG + Intergenic
1115389861 14:32842295-32842317 TGACCTCCAAAATTGGAGGTGGG + Intergenic
1115561467 14:34586711-34586733 CAAAAAAACAAATTGGAGGTCGG + Intronic
1116751964 14:48897808-48897830 GAAAATGAAGAATTGGAGGTTGG + Intergenic
1119778627 14:77263713-77263735 CAAAAACAAAAATGGGAGGGGGG + Intergenic
1121161916 14:91751345-91751367 CAAAAGTCAAAATTGAGGGTTGG - Intronic
1121196637 14:92078837-92078859 AATAATCCAAACTTGCAGGTGGG + Intronic
1122253527 14:100459481-100459503 CAAAATATAAATTTGGAGTTGGG - Intronic
1122518755 14:102327548-102327570 CAATCTCCAAAGTTAGAGGTGGG - Intronic
1124908561 15:33895678-33895700 CAGAATACTATATTGGAGGTAGG - Intronic
1125540832 15:40469080-40469102 CAAAATGCAGAAGTGGAGGCGGG - Intergenic
1125789612 15:42354194-42354216 CAAATTCAGAAATGGGAGGTAGG - Exonic
1126223988 15:46248445-46248467 CAAAAGCCAAAATTCTAGGAAGG + Intergenic
1126552554 15:49948810-49948832 CAAAATCCAAAATTGACTGATGG - Intronic
1127312045 15:57760978-57761000 CTAAATGCAAAATTGGACCTGGG + Intronic
1127673110 15:61214588-61214610 CAAAATCCAAAAGCGGGGGCAGG + Intronic
1128539946 15:68519606-68519628 CAAAATCAAAAGTTGGTTGTTGG - Intergenic
1129982970 15:79891322-79891344 CAAAATACAAAATAGAAGGATGG + Intronic
1130067056 15:80613664-80613686 AAAAAGCCAAACTTGGAGGACGG + Intergenic
1130783179 15:87066657-87066679 CAAAATGAAAACTTGGAGGCAGG + Intergenic
1130863945 15:87915980-87916002 CAAAGAGCAAAGTTGGAGGTAGG - Intronic
1131605953 15:93902456-93902478 CCAAATCCAAATCTGCAGGTGGG - Intergenic
1131719080 15:95147702-95147724 GAAAATCCAAAATTCAAGCTGGG + Intergenic
1132135315 15:99331880-99331902 CAAAATCTGAATTTGGAGATGGG - Intronic
1132445168 15:101911017-101911039 CAAAATTCAAAATTCGGAGTCGG + Intergenic
1133122599 16:3619520-3619542 AAAAATACAAAAATGGAGCTAGG - Intronic
1133486831 16:6227737-6227759 CAAAACACAAGTTTGGAGGTTGG - Intronic
1133745162 16:8680722-8680744 AATAATCAAAAAATGGAGGTCGG - Intronic
1133767973 16:8850862-8850884 CAAAAAACAAAACTGAAGGTGGG - Intergenic
1135464874 16:22676650-22676672 AAATATCCCCAATTGGAGGTGGG + Intergenic
1135504436 16:23023885-23023907 CAAAATCTAAGATTGGTGGATGG - Intergenic
1135557598 16:23450092-23450114 AAAAATACAAAATTAGAGGTGGG - Intronic
1136280560 16:29206667-29206689 TAAGATCCATAATTGGAGGTGGG + Intergenic
1137732902 16:50702289-50702311 CAAAAGCAAACATTGAAGGTTGG + Intronic
1137978062 16:53047694-53047716 CAACATATAAATTTGGAGGTAGG + Intergenic
1138637818 16:58356670-58356692 CCAAATCCAAAATTAGAAGAAGG - Intronic
1138671725 16:58621119-58621141 AAAAATACAAAACTTGAGGTGGG - Intronic
1139995025 16:70972954-70972976 TAAGATCCAAAACTGGGGGTGGG - Intronic
1140260175 16:73371374-73371396 TAAAATAAAAAATTGGGGGTTGG - Intergenic
1141961130 16:87410083-87410105 CAAAACCCTAGATTGGAGCTTGG - Exonic
1142084922 16:88172614-88172636 TAAGATCCATAATTGGAGGTGGG + Intergenic
1142694421 17:1625734-1625756 GAAAAACCAAAATTGGAGGCAGG + Intronic
1142699528 17:1650574-1650596 CTAAATCCAGAATTTGAGTTTGG + Intergenic
1142790785 17:2263966-2263988 CAAAAACCAATATAGGAAGTTGG + Intronic
1144280704 17:13723568-13723590 CAAAATGAAAAGTTGGATGTAGG + Intergenic
1144401542 17:14907813-14907835 TAATATCCAGTATTGGAGGTGGG - Intergenic
1146076488 17:29735008-29735030 CAAGGTTCAAAATTGGGGGTGGG + Intronic
1147320840 17:39645031-39645053 GGAAATTGAAAATTGGAGGTGGG + Intronic
1147626708 17:41905032-41905054 CAACATCCAAAAATCCAGGTTGG + Intronic
1148926275 17:51088797-51088819 CAAAAAAAAAAATGGGAGGTGGG + Intronic
1149575146 17:57706645-57706667 CAAACTATAAAATGGGAGGTAGG + Intergenic
1149958690 17:61082498-61082520 AATAATCCAGAGTTGGAGGTAGG - Intronic
1150475470 17:65471383-65471405 CAAAATAGAAAATCGGAGGGTGG + Intergenic
1151925071 17:77189582-77189604 CAAACTACAAAATGGGAGGAGGG - Intronic
1151991658 17:77579031-77579053 TAAAATACAAAATTAGAGGCCGG - Intergenic
1158643833 18:59225935-59225957 AAAACTCCTAAATTGGAGTTTGG - Intronic
1158756094 18:60327380-60327402 CAAAAGACAAAAAAGGAGGTAGG - Intergenic
1158863291 18:61614203-61614225 TAATCTCCAACATTGGAGGTGGG + Intergenic
1159114897 18:64102901-64102923 CAATCTCCAATGTTGGAGGTGGG - Intergenic
1159241048 18:65744384-65744406 CTAAATCCAAAATTGAGGGAGGG - Intergenic
1159572532 18:70134283-70134305 CAAAATAAAAAATTGGTGGTGGG + Intronic
1160640143 19:122690-122712 CAAAATTCAAAATTCGGAGTCGG - Intergenic
1160915326 19:1493580-1493602 CAACAGCCAAAACTGGGGGTGGG - Intronic
1161402007 19:4070401-4070423 AAAAATACAAAATTAGAGGCCGG - Intergenic
1161612447 19:5250787-5250809 CAAAAACCAAAAAAGGGGGTTGG + Intronic
1162315745 19:9936904-9936926 CAGAATCTGAAATTGGAAGTTGG + Intergenic
1162987410 19:14279754-14279776 CCAAAACCAAAATGGGGGGTGGG + Intergenic
1163224761 19:15950876-15950898 CAAAATAGAAAAAAGGAGGTTGG + Intergenic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1165863615 19:38922544-38922566 CAAAATCCACTTTAGGAGGTAGG + Intronic
925666350 2:6260555-6260577 GAAAATACAAAATTGGGGGATGG + Intergenic
926778297 2:16443921-16443943 CAACATACAAATTTGGGGGTGGG + Intergenic
929507719 2:42541324-42541346 CAAAATTCAAAATTTGGGCTGGG - Intronic
930593736 2:53359960-53359982 CAAAATGTTTAATTGGAGGTAGG + Intergenic
930843444 2:55874292-55874314 CTACATGCAACATTGGAGGTAGG + Intronic
930932999 2:56911517-56911539 CAGAATCAAAAATTGGGAGTAGG + Intergenic
931512116 2:63010250-63010272 CTGAATCCAGAATTAGAGGTTGG + Intronic
931845296 2:66197662-66197684 AAAAATCAAAAATTAGATGTTGG + Intergenic
933669563 2:84993874-84993896 CAAACTCAAAAATGGGGGGTAGG - Intronic
935702422 2:105824125-105824147 CAAAACCCAAAATGGAATGTTGG - Intronic
936116293 2:109705730-109705752 CAAAATACGAACTTGGGGGTGGG + Intergenic
936596855 2:113856440-113856462 CAACATCTAAATTTGGGGGTGGG - Intergenic
936652149 2:114440120-114440142 CAAAATCCAAAATGAGATTTGGG + Intergenic
936851366 2:116902258-116902280 CCAAAGCCAAAATTGGTGGAAGG - Intergenic
938154153 2:128915707-128915729 TAAAATTTAAAATTGGAGGCTGG + Intergenic
939243706 2:139595350-139595372 CAATCCCCAAAATTGGAGGTGGG + Intergenic
941073078 2:160976583-160976605 CAAAAGCCAAAATTGGCAATTGG - Intergenic
942400396 2:175595460-175595482 CATGATCCAAAATTGGCTGTTGG - Intergenic
942798802 2:179852472-179852494 CAAAATCTAAAAGAGGTGGTAGG - Intronic
943660829 2:190557454-190557476 CAAAAGCCAAAATTGAAAGTGGG + Intergenic
944029470 2:195216749-195216771 CAAAATATAAATTTGGAGGTGGG + Intergenic
946242382 2:218364601-218364623 CAACAGCCAAAATTGGGGGGTGG - Intronic
947617397 2:231567196-231567218 CAATATATAAATTTGGAGGTGGG - Intergenic
948078970 2:235189944-235189966 TAAACTCCAAAGTTGGAGGTGGG + Intergenic
1168872011 20:1137543-1137565 CAACATCCAAAATTGGAATATGG + Intronic
1168937419 20:1677799-1677821 AAAAATACAAAATTGAAGATAGG + Intergenic
1168944269 20:1738657-1738679 CAATCCCCAATATTGGAGGTAGG + Intergenic
1169083524 20:2813247-2813269 CAAATCCCAATGTTGGAGGTAGG + Intergenic
1170875800 20:20248875-20248897 CAAAAAGCAAAAATGGAGGACGG - Intronic
1171539690 20:25938048-25938070 CAAAATTCGTAATTGTAGGTGGG - Intergenic
1171842619 20:30233276-30233298 TAAAATTCATAATTGTAGGTGGG - Intergenic
1172957379 20:38770804-38770826 CAACATGCACAAATGGAGGTGGG - Intronic
1173494394 20:43508137-43508159 AAAAATCCAAAATTAATGGTAGG - Intronic
1174594976 20:51676773-51676795 AAAAATACAAAAATTGAGGTTGG - Intronic
1175109154 20:56634152-56634174 CCAAATCGAAAAATGGAGGCCGG + Exonic
1177071354 21:16512673-16512695 AAAAATCCAAAAATGTTGGTTGG - Intergenic
1177553092 21:22651222-22651244 CAAAATACAAAATTCTAGTTAGG - Intergenic
1179391745 21:40999252-40999274 CAAAAGCCAAAATTGTACATTGG - Intergenic
1180644340 22:17326171-17326193 CAAAATACAAAAATGTAGCTGGG + Intergenic
1181625949 22:24122214-24122236 CAAAATTAAAAGTTGGAGGGAGG + Intronic
1183105423 22:35611819-35611841 CAAGGTCTAAAGTTGGAGGTGGG - Intronic
1183610493 22:38900122-38900144 CAAAATACAAAATTGGGAATTGG - Intergenic
1183839298 22:40484775-40484797 CAAAATCTAAAAGTAGAGGCGGG + Intronic
1185262303 22:49874532-49874554 AAAAATACAAAAATGGTGGTGGG - Intronic
949350555 3:3121339-3121361 TAATCTCCAATATTGGAGGTGGG + Intronic
949892670 3:8745036-8745058 TAATCTCCAATATTGGAGGTGGG + Intronic
951226231 3:20124571-20124593 CAATCTCCAATGTTGGAGGTGGG - Intronic
953013892 3:39053900-39053922 CAAAGTACAAAATTAGAGTTTGG + Intronic
954099996 3:48364230-48364252 TAATCTCCAAAATTGGAGGTGGG + Intergenic
954497698 3:50980984-50981006 CCAAATCCAAAATTAGTGGATGG - Intronic
955681283 3:61504866-61504888 CAACATCAAAGATTGAAGGTAGG - Intergenic
956891194 3:73615929-73615951 CTAATTCCAACATTGGAGGTGGG + Intronic
956981339 3:74642220-74642242 AAAAGTCCAAAATTGGTGTTTGG + Intergenic
957609735 3:82451688-82451710 TAATCTCCAACATTGGAGGTGGG + Intergenic
959414564 3:106068262-106068284 CAAAAACCAAAAAAGGTGGTGGG + Intergenic
960215955 3:115037442-115037464 AAAAATCCAAAAATTGAGCTGGG - Intronic
960265575 3:115617281-115617303 CAAGATCCAAGATTTGAAGTAGG - Intergenic
960480572 3:118183332-118183354 CAAAAACAAAAATTGGCAGTGGG - Intergenic
961983845 3:131111139-131111161 CAAAATACAAAACTGGAATTTGG + Intronic
962216460 3:133526575-133526597 AAAAATACAAAATTAGAGGGGGG - Intergenic
963163451 3:142176288-142176310 AAAAGTCCAAAATTTGAGTTTGG - Intronic
963369674 3:144382715-144382737 GAAAACCCTAATTTGGAGGTTGG + Intergenic
963515013 3:146298694-146298716 CCAAATCCTAAATTGTAGTTTGG - Intergenic
964277297 3:155022054-155022076 CAACATATAAACTTGGAGGTTGG + Intergenic
964534900 3:157709742-157709764 CAAAATTTAAAATTGCAAGTAGG + Intergenic
964890125 3:161524786-161524808 CAAAACCCAAAAAAGGAGGATGG - Intergenic
965057696 3:163743654-163743676 TAAACCCCAATATTGGAGGTGGG - Intergenic
965125304 3:164619896-164619918 TAATTTCCAAAATTGGAGGTAGG - Intergenic
965725989 3:171716754-171716776 CAAAATCAAAAATTGGCGAATGG - Intronic
966693510 3:182765042-182765064 CAAAATCAAACATAGCAGGTAGG + Intergenic
970909621 4:21259496-21259518 GAAAAACAAAGATTGGAGGTAGG - Intronic
971602935 4:28618991-28619013 CAAAATGAAAAATTGCAAGTGGG - Intergenic
971926281 4:33013150-33013172 CAATAGACAAAATTGGAGGAGGG + Intergenic
973574249 4:52270155-52270177 CAGAATTCAAAATTGGAGTAAGG + Intergenic
974254045 4:59426234-59426256 CAAAATCCAAAATATGAGTTTGG - Intergenic
974273564 4:59685199-59685221 CAAAATCAAATATAGGATGTTGG + Intergenic
974879922 4:67742585-67742607 CTAAGTCCAAAATTTCAGGTAGG - Intronic
975121016 4:70728404-70728426 CAAAATTCAAAATTTGAAGTAGG + Intronic
977393929 4:96448671-96448693 CAAAAGTCAAGAATGGAGGTTGG + Intergenic
978184937 4:105846237-105846259 AAAAATCCAAAAAATGAGGTGGG + Exonic
978508182 4:109483481-109483503 CAAAATCCAAAATTTTATGAGGG - Intronic
979476619 4:121165763-121165785 CAAAATCCAAAAATACAGGTAGG + Intronic
979958481 4:126986674-126986696 CAAAGTCAAGAATTGGAGGCAGG + Intergenic
980458390 4:133074019-133074041 TAAACCCCAAAGTTGGAGGTGGG + Intergenic
980726714 4:136770813-136770835 CAAAAACAAAAATTGGTAGTGGG - Intergenic
982585270 4:157228933-157228955 CTAAAACCAAAATTGAAGCTTGG - Intronic
982589513 4:157288531-157288553 TAAAGTCCAGGATTGGAGGTGGG - Intronic
983550827 4:169015766-169015788 CAAAATCCAAACTGAGAGATGGG - Intergenic
983760375 4:171397910-171397932 TAAAAGAAAAAATTGGAGGTAGG - Intergenic
984309874 4:178043349-178043371 CAAACTCCAATATTGTACGTAGG + Intergenic
985343566 4:188976950-188976972 CAAAATCCAAAATGGGCTGGGGG - Intergenic
986383248 5:7207388-7207410 CAATATCCAAAACTTGAGCTTGG - Intergenic
987140047 5:14936443-14936465 AAAAATGCAAAATTGGAATTCGG + Intergenic
987168936 5:15232575-15232597 CAAAATCCACAAATGCAAGTGGG - Intergenic
988299871 5:29408721-29408743 CTAAATCCAAAATTGGTAGAAGG + Intergenic
988834203 5:35015492-35015514 CAAAATGCAAAATGGGGGTTAGG + Intronic
989983510 5:50668733-50668755 CTAAATTCAAAATTGGATTTGGG - Intronic
990058960 5:51622709-51622731 CAAAATACAGAATTAGAGTTGGG + Intergenic
993015832 5:82533519-82533541 CAAATTCCAAATTTGTAGGCAGG - Intergenic
994721045 5:103380841-103380863 CAAAAGCCAAAATTGAAAATGGG - Intergenic
994821461 5:104656134-104656156 CAAAATCCAAAATTAGTAGAAGG + Intergenic
995690955 5:114825325-114825347 CAGAAGTCAAAAATGGAGGTTGG - Intergenic
995797282 5:115955488-115955510 TAACATAAAAAATTGGAGGTGGG - Intergenic
996535991 5:124578399-124578421 GAAAATTCAAAATTGGATGAGGG + Intergenic
997927218 5:138041770-138041792 CAAAAAAAAAAATTGGGGGTGGG + Intronic
997938365 5:138134537-138134559 AAAAATCCAAAATTAGGGCTGGG - Intronic
998117974 5:139552976-139552998 AAAAATACAAAATTAGAGGCCGG - Intronic
999273915 5:150315759-150315781 CACAATCAAACATTGGAGATAGG + Intronic
1000692229 5:164337941-164337963 CAATCTCCAATGTTGGAGGTAGG - Intergenic
1000992616 5:167926558-167926580 AAAAATCCAAAATAGTAGCTGGG + Intronic
1001081814 5:168672772-168672794 CAAAGGCCAAAAATGGAAGTAGG - Intronic
1002747493 6:71097-71119 CAAAATTCAAAATTCGGAGTCGG - Intergenic
1007744799 6:44037010-44037032 CACAATACAAAATCGGAGTTTGG + Intergenic
1008478394 6:51958356-51958378 GAAAAACCACTATTGGAGGTTGG + Intronic
1009398068 6:63225416-63225438 TAAAATTAAAAAATGGAGGTTGG - Intergenic
1010060440 6:71616261-71616283 TAATCTCCAATATTGGAGGTGGG - Intergenic
1010849274 6:80751498-80751520 CAAAATACAATTTTGGAGGGAGG - Intergenic
1012369137 6:98481492-98481514 CAAAAGCCAAAATTGCAAATGGG + Intergenic
1012445717 6:99305220-99305242 TAAAAACCAAAACTGGAGGTTGG + Intronic
1012938634 6:105394206-105394228 CAAAATCCAAAACTAAAAGTAGG + Intronic
1013628954 6:111966560-111966582 CAAAATAAAACATTGGAGGGAGG + Intergenic
1013668704 6:112375224-112375246 CAAGATCCAAAATGGCAGGAAGG + Intergenic
1015136512 6:129878293-129878315 CAAAATCCAAAATGAGAAATGGG - Intergenic
1015602502 6:134924115-134924137 CAAAATCCAAATAGGGAGCTGGG + Intronic
1016266682 6:142240636-142240658 TAAAATACATAATTAGAGGTTGG - Intergenic
1016425025 6:143926151-143926173 CCAAATCCAAAATTAGCGGAAGG - Intronic
1016650938 6:146459486-146459508 CAAAATCCAAAATTAGTAGAAGG - Intergenic
1017945167 6:159090705-159090727 CAACCTGCCAAATTGGAGGTGGG - Intergenic
1018325138 6:162659258-162659280 AAAAATCCAAAGCTGGAAGTTGG - Intronic
1018443907 6:163837686-163837708 CAAACTCCAACAGAGGAGGTGGG - Intergenic
1019560290 7:1652548-1652570 AAAAAAAAAAAATTGGAGGTTGG - Intergenic
1020584752 7:10052453-10052475 CAAAAGCCAAAATTGTAAATTGG + Intergenic
1020928259 7:14359446-14359468 CAAAAGCCAAAATTGAAAGTGGG + Intronic
1021352371 7:19610879-19610901 CAAAATCCAAAAGTGTTGGGTGG - Intergenic
1022056248 7:26737948-26737970 TAAAATCCCAAATTTGAGCTGGG + Intronic
1022467427 7:30661100-30661122 CAAAATCCCAGGCTGGAGGTAGG - Intronic
1022601720 7:31767297-31767319 TAAACTCCAATGTTGGAGGTAGG + Intronic
1023058519 7:36308615-36308637 CAGAAGCCAGAAGTGGAGGTGGG + Intergenic
1025266463 7:57462861-57462883 CTGAATCAAAAATTGGTGGTAGG - Intronic
1025835996 7:65094193-65094215 TAAAATCCAAAATTATAGGCCGG - Intergenic
1025905766 7:65783653-65783675 TAAAATCCAAAATTATAGGCTGG - Intergenic
1025909042 7:65812690-65812712 CAAAAAACAAAACTGGAGTTTGG - Intergenic
1028857863 7:95612215-95612237 CAAAATCCACAAGTGGCGGGTGG - Intergenic
1030496920 7:110311924-110311946 CAATCTCCAATGTTGGAGGTGGG + Intergenic
1031112713 7:117631132-117631154 CAAAATCCAAAATTGGAGGTTGG - Intronic
1031285753 7:119865797-119865819 CAGAATCCAGAGTTGGAAGTGGG - Intergenic
1031790487 7:126095426-126095448 TAATCTCCAATATTGGAGGTAGG - Intergenic
1031797621 7:126196040-126196062 CAATCTCCAATGTTGGAGGTGGG - Intergenic
1035004813 7:155648207-155648229 AAATATACAAAAGTGGAGGTGGG - Intronic
1035013667 7:155743944-155743966 CAAACTGCAAAAATGAAGGTGGG - Intronic
1036614364 8:10377267-10377289 CAAAATCCCAAACTGGAAGGTGG + Intronic
1037595567 8:20351428-20351450 CAAAATACAAAATTAGATGGAGG - Intergenic
1038180092 8:25219468-25219490 CAAAATCCAACAATGGAGAGAGG - Intronic
1038877768 8:31570477-31570499 CAAAAGCCAAAATTGCAAATGGG + Intergenic
1040562798 8:48539595-48539617 CAAAAGCCAAAATTGACAGTTGG + Intergenic
1040680305 8:49801095-49801117 CAATCTCCAATACTGGAGGTAGG + Intergenic
1041132320 8:54714411-54714433 TAAAATCTAAGATTGGAGTTTGG + Intergenic
1043196853 8:77305108-77305130 CAAAATACAAAACTGGAGTTGGG - Intergenic
1044431045 8:92107363-92107385 CAAATTTCAAAAATGGGGGTGGG - Intergenic
1045273307 8:100680059-100680081 CCAAGACCAAAATTGGGGGTGGG + Intergenic
1045631271 8:104126218-104126240 CAAAATGCAAAATAAAAGGTTGG + Intronic
1046572777 8:115987621-115987643 CAAATTCCAAACTGGGAGGCTGG - Intergenic
1046631401 8:116626137-116626159 CCAAATACAACAGTGGAGGTAGG - Intergenic
1046845564 8:118911525-118911547 CAAAATACATAATTGGTAGTAGG + Intergenic
1047085991 8:121516051-121516073 TAGAATACAAAATTGTAGGTTGG - Intergenic
1047906801 8:129481191-129481213 CAAAATCCAAAATAGAAAGTTGG - Intergenic
1048653900 8:136513906-136513928 CAAACTACAAAATTGAAGGAAGG - Intergenic
1049876481 8:145025868-145025890 AAAAATCAAAAATTGGAGTGGGG + Intergenic
1050778367 9:9297681-9297703 TAAAATCCAACATTGATGGTTGG + Intronic
1050801329 9:9618136-9618158 AAAAAGGCAAGATTGGAGGTGGG + Intronic
1050934361 9:11376189-11376211 AAAACTACAAAGTTGGAGGTAGG - Intergenic
1051399190 9:16660937-16660959 CAAATACCAAAATTTGAGGACGG - Intronic
1052104217 9:24492409-24492431 CAAAATCCAAAGATGGAGCGAGG + Intergenic
1052153468 9:25150518-25150540 AAAAGTCTAAAATTGGAGGAGGG + Intergenic
1052809344 9:33043438-33043460 CAGAATCAGAAATTGGTGGTGGG - Exonic
1054165370 9:61721387-61721409 TAAAATTCATAATTGTAGGTGGG + Intergenic
1054845952 9:69798640-69798662 CAAAATCAAAAACTGCAGGAAGG - Intergenic
1055937770 9:81619325-81619347 AATAATCCAATACTGGAGGTGGG + Intronic
1056497649 9:87176008-87176030 CAATCTCCAATGTTGGAGGTGGG + Intergenic
1057562953 9:96142384-96142406 CAAAATCCAAAATTTTAGCATGG + Intergenic
1057766638 9:97925546-97925568 GACAATCCTAAAGTGGAGGTAGG - Intergenic
1058421597 9:104838027-104838049 CAAAAACCAAAATTTGGGGCTGG + Intronic
1185990161 X:4885542-4885564 CAAAATTCAAAATTGGCAGTAGG - Intergenic
1186145110 X:6617074-6617096 TAATCTCCAACATTGGAGGTGGG + Intergenic
1188190492 X:27166329-27166351 CACAATCCAAAACTGGAAGGTGG + Intergenic
1188998445 X:36915386-36915408 CAAAAGCCAAAATTGAAAATGGG + Intergenic
1189594263 X:42547756-42547778 CAATACCCAGTATTGGAGGTGGG - Intergenic
1190278825 X:48916550-48916572 AAAAATACAAAATTAGAGGCCGG + Intronic
1190618078 X:52258743-52258765 TCAAGTCCAAAATTGCAGGTAGG - Intergenic
1191770185 X:64747165-64747187 TAACATCCAGAGTTGGAGGTGGG - Intergenic
1191818678 X:65277824-65277846 CAAAATCCAAAATTAGTAGAAGG + Intergenic
1191934421 X:66411122-66411144 CAAAATCCATAATTAGTTGTTGG - Intergenic
1191950691 X:66588710-66588732 AAAAATCAAAAATTAGATGTTGG - Intergenic
1192231611 X:69269261-69269283 CAAAAACCAGAATTGGAATTGGG - Intergenic
1192975654 X:76281545-76281567 CAAAAGCCAAAATTGGCAATGGG - Intergenic
1192999047 X:76543638-76543660 CAAAAGCCAAAATTGACAGTTGG - Intergenic
1193038055 X:76974721-76974743 CTAAATTCAAAATTGGATTTTGG + Intergenic
1193060619 X:77202998-77203020 CAAAATCCAAAATAGAAAATTGG - Intergenic
1193142616 X:78043952-78043974 CAAAATACAAAGTTGAAGGCTGG - Intronic
1194852415 X:98885908-98885930 CAAAAGCCAAAATTGAAAATGGG + Intergenic
1195071840 X:101288917-101288939 TAAAAGCCAAATTTGGAAGTGGG + Intronic
1195286551 X:103390926-103390948 CAAAATCCAAAATTAGCAGAAGG + Intergenic
1196338582 X:114569087-114569109 TAGAAACCAAAATTGGAGGCCGG + Intergenic
1197169923 X:123421206-123421228 CAAAAGACAATATTGGAGGAGGG - Intronic
1197672092 X:129288258-129288280 TAATATCCAATGTTGGAGGTGGG - Intergenic
1198458826 X:136843900-136843922 AAAAATCCATAATTGTAGATGGG - Intergenic
1198712375 X:139519409-139519431 GCAAATCCAAAATTATAGGTGGG + Intergenic
1200412025 Y:2870330-2870352 AAAAATCCAAAAATGGAGCCAGG + Intronic
1202013896 Y:20379767-20379789 CAAAAGCCAAAATTGAAAATGGG - Intergenic
1202341758 Y:23876552-23876574 CAAAATCCAAAATTGACATTTGG - Intergenic
1202529008 Y:25793534-25793556 CAAAATCCAAAATTGACATTTGG + Intergenic