ID: 1031116655

View in Genome Browser
Species Human (GRCh38)
Location 7:117676183-117676205
Sequence CAGGGTGATAGTACAGTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 54}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031116655 Original CRISPR CAGGGTGATAGTACAGTTAC AGG Intronic
908571460 1:65415712-65415734 CATGTAGATAGTACAGTGACAGG - Intronic
921677658 1:217994206-217994228 GAGGGTGTCAGTTCAGTTACAGG + Intergenic
1063170159 10:3502401-3502423 CTGGGTGCTGGTACAGTTTCAGG + Intergenic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1079612179 11:22446892-22446914 CAGAGTGATAGTAGAGATAAGGG + Intergenic
1086219627 11:84427115-84427137 CAGGGGGATAGTAGAGTAAGAGG + Intronic
1087856041 11:103092513-103092535 CAGGGTGACAATGCATTTACGGG - Intergenic
1094536227 12:31324720-31324742 CAGGGTGATCGTCCAGTGTCCGG - Intronic
1099044353 12:77697224-77697246 CATGGTGATAGTGCATCTACAGG - Intergenic
1099101383 12:78445569-78445591 CAGAATGATAGTACAGTTGTGGG - Intergenic
1100218384 12:92477440-92477462 GAGGGAGATAGGACAGTTTCAGG - Intergenic
1109833474 13:67825038-67825060 CAGGGGGATACTACAGACACTGG - Intergenic
1111772225 13:92611409-92611431 CATGGTGATAGTAAAGATATTGG - Intronic
1113225505 13:108154929-108154951 CAGGGTGAGAATAAAGTTGCAGG + Intergenic
1113283100 13:108812206-108812228 CAGGGTGCTTGTACAGGGACAGG - Intronic
1113936654 13:113998460-113998482 GAGGGTCATAGAACAGTTGCAGG - Intronic
1114277447 14:21159515-21159537 CAGGGTTATAGTAAAGTTAGAGG + Intergenic
1114277919 14:21164723-21164745 CAGGGTTATAGTAAAGTTAGAGG - Intergenic
1115631411 14:35249639-35249661 CAGTGTGATAGTATATTTCCTGG + Intronic
1121008999 14:90508986-90509008 CAGGGTGATCGGACAGTGCCCGG - Intergenic
1126215709 15:46152103-46152125 CAGGGAGACAGAACAGTTACAGG - Intergenic
1127349195 15:58133625-58133647 TAGGGTTATACTACATTTACTGG - Intronic
1127724090 15:61730672-61730694 CAGGGTCTTAGTACTGTCACAGG - Intergenic
1131324543 15:91429786-91429808 CAGGGTGAAAGTCCAGTAACTGG + Intergenic
1132056320 15:98652031-98652053 CAGGGTGTTGGTTCAGTTGCAGG + Intronic
1137994871 16:53199629-53199651 CAGGGTGAAAGAACAGACACTGG - Intronic
1143829350 17:9638651-9638673 CAGGGTGATAGCACACACACTGG - Exonic
1151702630 17:75751418-75751440 TAGGGTGAGAGGAAAGTTACCGG + Intronic
1155456849 18:26026019-26026041 CAGAATGATTGTACAGTTACTGG + Intronic
1159238150 18:65704676-65704698 CAGGTTGATGGTACAGCTTCTGG - Intergenic
1164268997 19:23652799-23652821 GAGGGTTGTAGTACATTTACTGG - Exonic
928029120 2:27763935-27763957 CAAGGTGAGAGTCCAGTTTCCGG - Intergenic
933702122 2:85263094-85263116 CAGGGTGGTAGTCCAGTCACTGG + Intronic
935145164 2:100390564-100390586 CAGCAGGATAGTGCAGTTACAGG - Intergenic
946995798 2:225389657-225389679 CAGGGTAATATGACAGTGACTGG + Intergenic
1174380865 20:50154509-50154531 CAGGGTGATGTCACAGTGACTGG - Intergenic
1175058855 20:56223119-56223141 TAGGGTGAAAGTACATTTCCGGG - Intergenic
1177676899 21:24311897-24311919 CATGGAGATATTACAGTTTCTGG - Intergenic
1179903068 21:44405135-44405157 CAGGGTCATAGAAGAGCTACTGG - Exonic
1181774988 22:25153087-25153109 CTATGTGGTAGTACAGTTACTGG - Intronic
1182972884 22:34594049-34594071 CATGGTGATAGCACAGTTAAGGG + Intergenic
959940560 3:112076746-112076768 CAGGGTGTTATTATAGTCACTGG - Intronic
968339030 3:197939329-197939351 GAGGTTGATAGTACATTTAGTGG + Intronic
969292603 4:6250280-6250302 CAGGAGGAAAGTGCAGTTACAGG - Intergenic
971125655 4:23751194-23751216 CAGAGAGAGAGAACAGTTACTGG - Intergenic
983381125 4:166994837-166994859 CAGGGTGATAATAGAATAACTGG + Intronic
986505247 5:8443095-8443117 CAAAGTGATAGTGCAGTTTCAGG - Intergenic
994606418 5:101972943-101972965 CAGTGTGATGCTACACTTACCGG - Intergenic
995919203 5:117290513-117290535 CAGAGTGACAGTTCAGTGACCGG - Intergenic
1000848471 5:166310596-166310618 CAGGTTGATAGCACAGATAAAGG - Intergenic
1004016135 6:11733584-11733606 CAGGGTGATAGGACTGTAATAGG - Intronic
1010101423 6:72112512-72112534 CAGGCAGATAGGACAGTGACAGG - Intronic
1011725583 6:90207075-90207097 AAGGGTCATTGTACAGTTTCAGG + Intronic
1015141820 6:129942855-129942877 CAGGTTAATAGTAATGTTACTGG - Intergenic
1017314124 6:153010064-153010086 AAGGATGATATTACAGTTACAGG - Exonic
1020648342 7:10843615-10843637 AAGGGTGATACTAAAGTTAAAGG + Intergenic
1030364165 7:108627116-108627138 CAGGGTGTTTGTTCAGTTCCTGG - Intergenic
1031116655 7:117676183-117676205 CAGGGTGATAGTACAGTTACAGG + Intronic
1037527437 8:19740421-19740443 CAGGATGAAAGGACAGTGACGGG + Intronic
1038360179 8:26867188-26867210 AAGGGTGATTGTGGAGTTACCGG - Intronic
1059856120 9:118399247-118399269 GCAGGTGATAGTACAGTGACAGG - Intergenic
1187966414 X:24616611-24616633 CAGGGTGATTCTAAAGTTAGTGG - Intronic
1188538127 X:31219687-31219709 CAGGGTGAGATTACAATTATTGG - Intronic