ID: 1031125372

View in Genome Browser
Species Human (GRCh38)
Location 7:117767954-117767976
Sequence CAAGTGGTAAACATTGATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031125372_1031125375 5 Left 1031125372 7:117767954-117767976 CCTGTATCAATGTTTACCACTTG 0: 1
1: 0
2: 1
3: 7
4: 119
Right 1031125375 7:117767982-117768004 TTGTTGGCTAATTTCCCACAAGG No data
1031125372_1031125376 11 Left 1031125372 7:117767954-117767976 CCTGTATCAATGTTTACCACTTG 0: 1
1: 0
2: 1
3: 7
4: 119
Right 1031125376 7:117767988-117768010 GCTAATTTCCCACAAGGCTAAGG 0: 1
1: 0
2: 1
3: 10
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031125372 Original CRISPR CAAGTGGTAAACATTGATAC AGG (reversed) Intronic
901884080 1:12210540-12210562 CAAGTGTAAAATATTGATTCTGG - Intergenic
907550289 1:55299249-55299271 CAAGAGGGAAATATTGTTACTGG - Intergenic
911819990 1:102405989-102406011 TAAGTGGTAAACAATGAAATAGG + Intergenic
912004670 1:104882745-104882767 CAAGGGGTGAACTGTGATACTGG + Intergenic
912746651 1:112250758-112250780 CAACTGGTAAACCTAGGTACAGG + Intergenic
916268026 1:162911285-162911307 AAAATAGTAAACATTGATAAGGG - Intergenic
917614315 1:176723608-176723630 CAAGTGAGAAACAATGATAGTGG + Intronic
917656808 1:177134744-177134766 GAAGTGGTAAAAATGTATACAGG + Intronic
924920589 1:248625266-248625288 CAAAGGGCAAACATGGATACAGG - Intergenic
1068201147 10:53785938-53785960 CAAGTAGTAATCATTTTTACAGG - Intergenic
1069333351 10:67319532-67319554 AAAGTGCTAATCATTGATACTGG + Intronic
1070292581 10:75128747-75128769 GAAGTGGTACACAGTGATACTGG + Intronic
1073599580 10:104833562-104833584 CACGTGGTGAGCATTCATACAGG + Intronic
1074825662 10:117214100-117214122 TAAATGGTGAACATTGCTACAGG + Intergenic
1075944687 10:126422266-126422288 CAAGGGGTAAAGATTGTTAGAGG - Intergenic
1079192238 11:18289206-18289228 CAAATGGGAAACAATGAGACTGG - Intronic
1079710075 11:23671624-23671646 CAAGTGAAAAACATATATACAGG + Intergenic
1081511957 11:43783783-43783805 AATGTGATAAACATTGATAGTGG - Intronic
1082854610 11:57795481-57795503 TAAGTGGTAAACCTGGAGACAGG - Intronic
1087766298 11:102158643-102158665 AAAGAGATTAACATTGATACTGG - Intronic
1087952473 11:104239996-104240018 CACGTGGTAAACATTATTTCTGG + Intergenic
1087991763 11:104752103-104752125 CAAATGGTAAATATGTATACAGG - Intergenic
1090469230 11:126964773-126964795 CAAGAGGTAAATATTGATGGAGG + Intronic
1092536150 12:9389108-9389130 CAAGTGGGTAACATTGTTTCTGG - Intergenic
1092665857 12:10796609-10796631 AAAATGGTAAAAATTAATACGGG + Intergenic
1092893761 12:12993771-12993793 CATGTGCTGAACATTGTTACAGG + Intronic
1096798923 12:54096575-54096597 CAAGTAGTAAACAGTGATCTAGG - Intergenic
1096902159 12:54895495-54895517 CTAGTGGGAAATATTGATAATGG + Intergenic
1096952874 12:55493167-55493189 GAAGAGGTAAACATTAATAAAGG + Exonic
1104686485 12:130788244-130788266 CAAATGGAAAACAATGAAACAGG + Intergenic
1105315630 13:19259262-19259284 CTACTGGTAAATATTGATACAGG - Intergenic
1105537856 13:21286784-21286806 CTACTGGCAAATATTGATACAGG + Intergenic
1106964448 13:35044420-35044442 TAAGTGGTAAAAATTGCTAATGG + Intronic
1109888912 13:68581287-68581309 GAAGTGGTAAAGCTTGATAAAGG + Intergenic
1111776836 13:92674053-92674075 CAAATGGCAAATATTGAAACTGG + Intronic
1115384208 14:32776854-32776876 AAAGTGGCTAACATTGCTACAGG + Intronic
1122335845 14:100981973-100981995 CCAGTGGTCATCATTGATCCAGG - Intergenic
1122658076 14:103275024-103275046 CAAGTTGTAAACAGTGATGGTGG - Intergenic
1123885939 15:24728435-24728457 TACATGGAAAACATTGATACTGG - Intergenic
1125489214 15:40134273-40134295 CAAGTGATAAATAGTGCTACTGG + Intergenic
1126477231 15:49078410-49078432 GGAGAGGTAGACATTGATACAGG - Intergenic
1127746211 15:61977328-61977350 AAATTGGTAATCATTGATTCTGG - Intronic
1131565910 15:93485339-93485361 AAAGTGCTAATCATTGAGACTGG + Intergenic
1132040322 15:98520028-98520050 TTAGTGGTAGACATTCATACAGG + Intergenic
1133533809 16:6680661-6680683 TAAGCGGTAAACTTTGATAGTGG - Intronic
1137796549 16:51224994-51225016 TAATTGGAAAACATAGATACAGG + Intergenic
1143946686 17:10598969-10598991 CAAGTGGAAAACACTGAAAAGGG - Intergenic
1144901695 17:18599453-18599475 CAAGTGGCCCACATTGATATTGG - Intergenic
1144929377 17:18846607-18846629 CAAGTGGCCCACATTGATATTGG + Intronic
1145130809 17:20346614-20346636 CAAGTGGTCCACATTGATATTGG + Intergenic
1146410840 17:32583289-32583311 CCAGTGATAAACATTGCTAGAGG - Intronic
1149701419 17:58658356-58658378 CAGGTGGTACACACTGGTACAGG - Intronic
1149827222 17:59840006-59840028 AAAGTTGTAAAAATTGATACAGG - Exonic
1153327383 18:3834748-3834770 CAAATAGTACAGATTGATACAGG - Intronic
1155005638 18:21726784-21726806 CATGTGGGAATCATTGTTACGGG - Intronic
1156621885 18:38862606-38862628 AAAAAGGTAAACCTTGATACAGG + Intergenic
1156895386 18:42240152-42240174 CAAATGGAAACCATTGCTACAGG + Intergenic
1164095552 19:22006914-22006936 CATGTGGTAAACAGTTATATGGG + Intronic
1165634956 19:37333052-37333074 CAAGTGATAAACAGTGAAAGGGG - Intronic
931420449 2:62122295-62122317 CAACTGGTAAACATTGAACAGGG - Intronic
932964403 2:76454722-76454744 TTATTGGTAAAGATTGATACTGG + Intergenic
933432463 2:82200687-82200709 AAAGTGGAAAACATGGAGACAGG + Intergenic
935730023 2:106057436-106057458 CAGGTGGTAAACAATGACTCAGG + Intergenic
937599188 2:123708787-123708809 AAAGTAGTAAACATTAGTACTGG - Intergenic
947239815 2:227982289-227982311 CAAGTGGTAAACTTTGATGCAGG + Intronic
1171797499 20:29577775-29577797 CAAGTAGTAAACAGTGATCTAGG + Intergenic
1171850753 20:30306386-30306408 CAAGTAGTAAACAGTGATCTAGG - Intergenic
1177044196 21:16148930-16148952 CTAGTGAAAAAGATTGATACTGG - Intergenic
1178963429 21:37090288-37090310 TAAGTGTTAAACACTGAAACTGG + Intronic
1179231061 21:39504247-39504269 CAAGGGGCAAACATTGATGTAGG + Intronic
1181417033 22:22767721-22767743 CAAGCCATGAACATTGATACAGG - Intronic
1183813656 22:40279941-40279963 CATGGGGGAAACATTGATTCTGG + Intronic
949450740 3:4182162-4182184 CAAGGTGTAAATAATGATACAGG + Intronic
953063586 3:39448851-39448873 CATGTTGTAAACATTTATAGTGG - Intergenic
955619636 3:60848747-60848769 CAGGTGGTAAGCATTCAAACTGG + Intronic
964333548 3:155630321-155630343 CAAATGGTAAAAAATGATAATGG + Intronic
965387520 3:168062736-168062758 CACGTGGTAATCATTGACAGAGG + Intronic
966078749 3:175973018-175973040 CAACTCGTAAACATTGTTAGTGG + Intergenic
968664935 4:1815880-1815902 CAAGTGGTCAGCACTGACACAGG + Intronic
971280137 4:25236099-25236121 CAAATTGTAAACTGTGATACAGG - Intronic
971829093 4:31666769-31666791 GAAGTGATAAACATTCACACTGG + Intergenic
975565777 4:75752991-75753013 CAAGTGGTATTCATTTACACTGG + Intronic
975687819 4:76934667-76934689 CAAGTGGCAGACATAGACACTGG - Intergenic
976167226 4:82268840-82268862 CAAGTGGGAAACATTGCTGAAGG - Intergenic
979051778 4:115944265-115944287 CCACTGGTAAGCATTCATACGGG - Intergenic
981952822 4:150430860-150430882 CAAGTAGTAATCATTTCTACAGG + Intronic
983422373 4:167535617-167535639 TAACTGTTAAACATTGCTACTGG - Intergenic
983494288 4:168425963-168425985 CCAGTTGGAGACATTGATACAGG + Intronic
988051624 5:26038426-26038448 CAAGTGGGAAATATTGAAGCAGG - Intergenic
988213843 5:28245701-28245723 AAAGTGGTAAAGATTGACAGTGG - Intergenic
991947789 5:71916448-71916470 CAAGTGGTCCACATTGGTATTGG - Intergenic
991967336 5:72106735-72106757 AAGGTGGTAAATATTGATATTGG + Intergenic
992980345 5:82164237-82164259 CAAATGTTAAACATTAATATGGG + Intronic
993821855 5:92629555-92629577 CAAGTTCTCATCATTGATACTGG + Intergenic
995242524 5:109901229-109901251 CATTAGGTAAACATTGACACCGG - Intergenic
998798513 5:145844016-145844038 CAATAGGTAAACATGGATATTGG + Intergenic
999623533 5:153496451-153496473 CTAGTGGGAAACATTGTTATGGG + Intronic
1003933479 6:10951741-10951763 CCTGTGGTAAACAATGATAAAGG - Intronic
1005655651 6:27933911-27933933 TGAGTGGTAAGAATTGATACTGG + Intergenic
1009463220 6:63938927-63938949 CAAAAGGCAAACATTGACACTGG + Intronic
1015486757 6:133780155-133780177 CAAGCGGTCAACATTAAAACTGG - Intergenic
1016463399 6:144302077-144302099 CACGTGGGAAAGATTGATTCTGG - Intronic
1016919552 6:149278466-149278488 AAAGTGGGACAAATTGATACAGG + Intronic
1020917745 7:14217701-14217723 CATGTGGAAAATATTCATACAGG - Intronic
1022180447 7:27913853-27913875 CACGTGGTAAAGCTGGATACAGG - Intronic
1031125372 7:117767954-117767976 CAAGTGGTAAACATTGATACAGG - Intronic
1040845027 8:51828776-51828798 CAAGTGATAATCACTGATTCTGG + Intronic
1043252311 8:78089974-78089996 AAAGTGGTAAAAATAGACACTGG + Intergenic
1045744444 8:105400843-105400865 CCAGTGCTCAACATTGACACCGG + Intronic
1048752219 8:137691987-137692009 CTGGTGGTAAACATTGACACCGG - Intergenic
1053788531 9:41669678-41669700 CAAGTAGTAAACAGTGATCTAGG - Intergenic
1054156608 9:61645090-61645112 CAAGTAGTAAACAGTGATCTAGG + Intergenic
1054176816 9:61881017-61881039 CAAGTAGTAAACAGTGATCTAGG - Intergenic
1054476378 9:65576099-65576121 CAAGTAGTAAACAGTGATCTAGG + Intergenic
1054660719 9:67699789-67699811 CAAGTAGTAAACAGTGATCTAGG + Intergenic
1056169915 9:83974973-83974995 CAAGTGGTGAACATTGTATCTGG + Intronic
1059284648 9:113162059-113162081 CAAGTGGGATACATTGCTTCAGG - Intronic
1059691085 9:116687007-116687029 GAAGGGGTAGACATTGAGACTGG + Intronic
1186669024 X:11750322-11750344 AAAGTGGTAAACAATGAGCCTGG - Intergenic
1187307759 X:18112295-18112317 CAAGATGTCAACATTGATAAAGG + Intergenic
1187345179 X:18457495-18457517 CAAGGGGAAAACATGGCTACTGG + Intronic
1188947922 X:36330903-36330925 AAAGAGGGAAACATTGATATAGG - Intronic
1192732274 X:73813012-73813034 GAAGTGGTAAACATTGTTAGGGG - Intergenic
1194074035 X:89366067-89366089 CAAGTGGTAAAAAGAGTTACTGG + Intergenic
1196242421 X:113357962-113357984 TAAGTGGAAAACAGTGATAGTGG + Intergenic
1197395305 X:125920190-125920212 CAAATAGTAAAAATTGATAAAGG - Intergenic
1197430069 X:126351285-126351307 CACGAGGCAAACATTGACACAGG - Intergenic
1200729423 Y:6717591-6717613 CAAGTGGTAAAAAGAGTTACTGG + Intergenic