ID: 1031125846

View in Genome Browser
Species Human (GRCh38)
Location 7:117772537-117772559
Sequence TTCCAGTTTAAACAGTTATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 185}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031125846_1031125848 -4 Left 1031125846 7:117772537-117772559 CCCTATAACTGTTTAAACTGGAA 0: 1
1: 0
2: 1
3: 18
4: 185
Right 1031125848 7:117772556-117772578 GGAACACATTAGAGAGTAAAAGG No data
1031125846_1031125850 20 Left 1031125846 7:117772537-117772559 CCCTATAACTGTTTAAACTGGAA 0: 1
1: 0
2: 1
3: 18
4: 185
Right 1031125850 7:117772580-117772602 GGCACTGTTAATAATTACACTGG No data
1031125846_1031125849 -1 Left 1031125846 7:117772537-117772559 CCCTATAACTGTTTAAACTGGAA 0: 1
1: 0
2: 1
3: 18
4: 185
Right 1031125849 7:117772559-117772581 ACACATTAGAGAGTAAAAGGAGG 0: 1
1: 2
2: 11
3: 40
4: 400
1031125846_1031125852 29 Left 1031125846 7:117772537-117772559 CCCTATAACTGTTTAAACTGGAA 0: 1
1: 0
2: 1
3: 18
4: 185
Right 1031125852 7:117772589-117772611 AATAATTACACTGGGATGACAGG 0: 1
1: 3
2: 7
3: 61
4: 284
1031125846_1031125851 21 Left 1031125846 7:117772537-117772559 CCCTATAACTGTTTAAACTGGAA 0: 1
1: 0
2: 1
3: 18
4: 185
Right 1031125851 7:117772581-117772603 GCACTGTTAATAATTACACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031125846 Original CRISPR TTCCAGTTTAAACAGTTATA GGG (reversed) Intronic