ID: 1031125937

View in Genome Browser
Species Human (GRCh38)
Location 7:117773438-117773460
Sequence CCACCTGATCAGAGGACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031125929_1031125937 20 Left 1031125929 7:117773395-117773417 CCTAACACATAAAAATGATCTAA 0: 1
1: 0
2: 12
3: 84
4: 917
Right 1031125937 7:117773438-117773460 CCACCTGATCAGAGGACAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031125937 Original CRISPR CCACCTGATCAGAGGACAGT GGG Intronic
900125191 1:1065793-1065815 TCACGTGATCACAGGACAGCGGG + Intergenic
900457464 1:2784192-2784214 TCACGTGATCAAAGGACAGTGGG + Intronic
900764370 1:4494233-4494255 CCTTCTGGTCAGAGGCCAGTGGG - Intergenic
901040872 1:6362570-6362592 CCAGCTCATCAGAGGGCACTCGG + Intronic
902303744 1:15521606-15521628 TCACGTGATCATAGGACAGGGGG - Intronic
907288865 1:53399897-53399919 TCACGTGATCATAGGACAGGGGG - Intergenic
907524295 1:55045194-55045216 GCAGCTGCTCAGAGGAGAGTAGG + Intronic
907640231 1:56181660-56181682 CCTCCTGATTAGATGACACTTGG + Intergenic
909056855 1:70831826-70831848 CATAATGATCAGAGGACAGTGGG + Intergenic
910872282 1:91845783-91845805 CCACCTAAACAGAGGACATGAGG + Intronic
911036084 1:93549881-93549903 CCACCTGTTTAGATGAAAGTGGG + Intronic
911501035 1:98684500-98684522 CCACCTTATAAGAGGGCTGTAGG - Intronic
918124669 1:181572523-181572545 CCCCCACAACAGAGGACAGTTGG - Intronic
918126041 1:181584876-181584898 ACACCTGATCCTAGGTCAGTTGG - Intronic
918751447 1:188276447-188276469 CCACCTGTTCATAGGACTTTAGG + Intergenic
919120482 1:193334208-193334230 CCACCTGCTTAGGGGAAAGTAGG - Intergenic
924234590 1:241990223-241990245 CCACCTGCTGAGAGGCCACTTGG + Intergenic
1063060748 10:2549831-2549853 CCATCTGATCAAAGGACAGGGGG - Intergenic
1068545645 10:58342263-58342285 CCATATGAATAGAGGACAGTGGG - Intronic
1069078786 10:64065966-64065988 TCACGTGATCATAGGACAGGGGG + Intergenic
1072499085 10:95994244-95994266 TCACCTGATCATGGGACAGGGGG + Intronic
1075645977 10:124096459-124096481 CCACCAGAGCAGAGGAAAGCAGG - Intergenic
1076693785 10:132237274-132237296 TGACCTGACCAGAGGCCAGTAGG + Intronic
1077001441 11:325071-325093 TCACGTGATCATAGGACAGGGGG + Intronic
1077052575 11:574351-574373 TCACGTGATCATAGGACAGGGGG - Intergenic
1079150590 11:17895749-17895771 CCACGTGTTAAGTGGACAGTGGG - Intronic
1081647036 11:44797321-44797343 CCACCTCATCAGGCTACAGTGGG - Intronic
1082843377 11:57707712-57707734 CCATCTGGACAGAGGAGAGTTGG - Intronic
1087982706 11:104635931-104635953 CCATGTGATCAGAGGAAAGATGG - Intergenic
1088803766 11:113332272-113332294 ACACATGATCAAAGGAGAGTGGG + Intronic
1088918850 11:114247133-114247155 CCCCCTCTTCAGGGGACAGTAGG - Intronic
1090948492 11:131452051-131452073 TCACCTGATCAGAGGCCATTTGG + Intronic
1094639325 12:32258662-32258684 TCACGTGATCATAGGACAGGGGG + Intronic
1101693800 12:107105864-107105886 CCATCTGTGCAGAGGCCAGTAGG - Intergenic
1104745878 12:131210280-131210302 CACCCTGATGAGAAGACAGTTGG + Intergenic
1104795812 12:131516660-131516682 TCACATGATCATAGGACAGGGGG + Intergenic
1104913726 12:132253012-132253034 TCACATGATCACAGGACAGGGGG + Intronic
1105855574 13:24368928-24368950 TCACATGATCATAGGACAGGGGG + Intergenic
1106051846 13:26197851-26197873 CCATATGATCAGAGAACAGACGG - Intronic
1106340826 13:28824987-28825009 CCACCTGACCAGAGTGCAGCTGG + Intronic
1108587737 13:51885379-51885401 GCACCTCTTCATAGGACAGTAGG + Intergenic
1111108464 13:83675671-83675693 TCACGTGATCACAGGACAGGGGG + Intergenic
1113008485 13:105735738-105735760 CCAGCTGCTCAGGGGAAAGTGGG + Intergenic
1114396156 14:22363936-22363958 CCATCTGACCAAAAGACAGTTGG - Intergenic
1114654074 14:24305496-24305518 CGAGGGGATCAGAGGACAGTGGG + Exonic
1116624789 14:47250588-47250610 CCACCATGTGAGAGGACAGTGGG + Intronic
1118859459 14:69651184-69651206 GGACCTGATCACAGGACAGGAGG - Intronic
1119087908 14:71754029-71754051 CAGCCTGAGGAGAGGACAGTGGG - Intergenic
1120983231 14:90309734-90309756 TGAGCTGGTCAGAGGACAGTGGG - Intronic
1121225219 14:92316821-92316843 CCAAGTGAGCAGAGGGCAGTGGG + Intergenic
1121732684 14:96197527-96197549 ACAAGTGATCAGAGGACAGGAGG + Intergenic
1127395581 15:58541766-58541788 CCACCTGAGGAGGGGACAGAGGG - Exonic
1127859157 15:62978716-62978738 CCTCCTCTTCAGAGGACAGAGGG + Intergenic
1129054480 15:72809185-72809207 CCACCTGAACTGAGGGCTGTGGG - Intergenic
1129167939 15:73789537-73789559 CCACTTGATCAGGGGAGAGAAGG - Intergenic
1130857651 15:87855328-87855350 ACACCTAATCAGAGTTCAGTAGG - Intergenic
1132315457 15:100886952-100886974 CCACCTGATCTGTGAACAGCAGG + Intronic
1132594078 16:740407-740429 CCACCTCATTTGAGGGCAGTAGG - Intronic
1135181748 16:20280832-20280854 GAAGCTGATCAGAGGACATTGGG + Intergenic
1138537447 16:57667456-57667478 CCACCTGATCAGTGACCATTTGG + Intergenic
1143459392 17:7091572-7091594 TCACGTGATCACAGGACAGGGGG + Intergenic
1143499955 17:7332816-7332838 TCACGTGATCACAGGACAGGGGG + Intergenic
1145745987 17:27320035-27320057 CCTCCTGATCTGAGGCCAGATGG - Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151720326 17:75851651-75851673 CCACGTGATCATAGGACATTAGG + Exonic
1152745927 17:82039199-82039221 TCACGTGATCATAGGACAGGGGG - Intergenic
1161399769 19:4062073-4062095 CCACCTGCTCAGGCGAGAGTGGG - Intronic
1162292476 19:9790568-9790590 TCACGTGATCATAGGACAGGGGG + Intronic
1163235904 19:16030350-16030372 TCACGTGATCATAGGACAGGGGG + Intergenic
1163403130 19:17106538-17106560 CCACCTGCTGGGAGGACACTGGG - Intronic
1163646905 19:18494772-18494794 CCACCTGGTCAGAGCCCAGAAGG - Intronic
1168304544 19:55428477-55428499 TCACATGCTCAGAGGACAGAGGG + Intergenic
925205282 2:2000612-2000634 CCACATGACCTGAGGACAGGGGG + Intronic
928953791 2:36840246-36840268 TCAACTGATCAGAGGCCAGTGGG + Intergenic
929085034 2:38159642-38159664 CACCCTTCTCAGAGGACAGTGGG + Intergenic
929944861 2:46362595-46362617 CCAGCTGATAAGAGAAAAGTGGG - Intronic
930842307 2:55861188-55861210 CCACCTGAACACAGCCCAGTGGG - Intergenic
931791971 2:65671808-65671830 CCACCTGAACAGAGGTCACCAGG + Intergenic
933650268 2:84844668-84844690 CCAGCTGATCTGAAGTCAGTTGG - Intronic
934136317 2:88999517-88999539 TCACGTGATCATAGGACAGGGGG + Intergenic
935732024 2:106072421-106072443 CCACCTGATCTGATTACAGCAGG - Intronic
944124324 2:196276156-196276178 CAACCAGACCAGCGGACAGTGGG + Intronic
944499883 2:200348551-200348573 CTATCTGAGCTGAGGACAGTGGG + Intronic
944528938 2:200649083-200649105 CCTCCTGGTCAGAGCTCAGTGGG - Intronic
944684246 2:202104359-202104381 CCAACAGATCAGGAGACAGTTGG + Intronic
946240931 2:218355271-218355293 TCACATGATCACAGGACAGGGGG - Intergenic
946405579 2:219490364-219490386 CCACCGGCTCAGAGGAGAGGAGG - Intronic
946646852 2:221846633-221846655 CCACCTGCTCAGATCACTGTTGG + Intergenic
947061351 2:226170106-226170128 CCCACTGATCATAGCACAGTAGG + Intergenic
1173985002 20:47254287-47254309 CCACCTCTTTAGAGGGCAGTTGG + Intronic
1175627679 20:60502477-60502499 CCACCTGAGCCCAGGACTGTGGG + Intergenic
1175762565 20:61571473-61571495 CCACGTGATCAGAGCACGGCAGG + Intronic
1175766471 20:61596074-61596096 CCTCATGCTCTGAGGACAGTTGG - Intronic
1175766843 20:61598176-61598198 TCAGCAGATCAGAGGGCAGTGGG - Intronic
1177173239 21:17676797-17676819 TCACATGATCACAGGACAGGTGG + Intergenic
1177772468 21:25531735-25531757 TCACGTGATCACAGGACAGGGGG + Intergenic
1179943385 21:44654268-44654290 CCACCTGCTCAGCAGCCAGTGGG + Exonic
1179970271 21:44833045-44833067 TCACGTGATCATAGGACAGGGGG - Intergenic
1180631320 22:17232180-17232202 CCACCTGTTGACAGGACAGCAGG + Intergenic
1182279813 22:29211754-29211776 CAATCTGGGCAGAGGACAGTCGG - Intronic
1183083076 22:35469636-35469658 TCACCTGAACAGCGGACAGCAGG - Intergenic
1183275341 22:36892970-36892992 ACACCTGTCCAGAGAACAGTAGG + Intergenic
1183627386 22:39012989-39013011 TCACGTGATCATAGGACAGGGGG + Intergenic
1184108341 22:42381492-42381514 CCACCAGGTCAGGGGCCAGTGGG + Exonic
950447694 3:13047752-13047774 CCATCTGAACAGGGGGCAGTGGG - Intronic
954468419 3:50672374-50672396 CCAGCTGAACTGAGGGCAGTTGG + Intergenic
963312055 3:143720437-143720459 CCACCTGAGGAGAATACAGTTGG + Intronic
966365785 3:179185978-179186000 CCACCTCCTCAGAGGAGAGAGGG - Intronic
969512490 4:7627310-7627332 TCAGCTAAGCAGAGGACAGTGGG + Intronic
971935608 4:33143498-33143520 CCACCTGATCAGCTGCCAGTAGG - Intergenic
973587998 4:52411426-52411448 TCAGCTCATCAGAGAACAGTAGG - Intergenic
976315686 4:83656499-83656521 CCACTTCAGCAGAGGACAGCTGG - Intergenic
986972062 5:13348552-13348574 TCACCTGCTCTGAGGACAGATGG - Intergenic
989190014 5:38661383-38661405 CCACTGGATCAGATGACAGGCGG + Intergenic
1001876494 5:175206271-175206293 CCACCCTATCAGAGGATGGTGGG - Intergenic
1005608056 6:27495476-27495498 ACCCCGGATCAGAGGAGAGTTGG + Intergenic
1006484447 6:34327140-34327162 TCACATGATCATAGGACAGGGGG + Intronic
1007036472 6:38678906-38678928 CCACATGATCTCAGGACAATGGG - Intronic
1019128661 6:169858452-169858474 CAACATGATCTGAGGACAGACGG + Intergenic
1023788706 7:43734839-43734861 TCACATGATCATAGGACAGGGGG + Intergenic
1025150314 7:56542068-56542090 CACCATGATCAGAGGACAGATGG - Intergenic
1028245925 7:88477188-88477210 CCACCTGCTGAGATGAGAGTGGG + Intergenic
1031125937 7:117773438-117773460 CCACCTGATCAGAGGACAGTGGG + Intronic
1035775476 8:2184220-2184242 CCACCTGAGCAGAGTCCAGTGGG + Intergenic
1041985376 8:63916368-63916390 CCACCTCAAGAGATGACAGTGGG - Intergenic
1042043026 8:64615044-64615066 CCACCTCACCAGAGAACAATTGG - Exonic
1044011009 8:86994402-86994424 CCACCTGGCCAGGAGACAGTGGG - Intronic
1045002863 8:97893458-97893480 CCACCTCCTCATAGGAAAGTGGG - Intronic
1049622015 8:143602701-143602723 CCATCTGAGCTGAGGACAGCTGG - Exonic
1049768283 8:144366032-144366054 TCACATGATCATAGGACAGGGGG - Intergenic
1061408915 9:130407788-130407810 CCACTAGTTCAGAGGACAGGAGG - Intronic
1062377670 9:136270383-136270405 TCACGTGATCATAGGACAGGGGG + Intergenic
1062379133 9:136278344-136278366 CCAACAGATCAGAGGACATGGGG + Intergenic
1062731866 9:138114374-138114396 CCAGCTGATGAGATGACAGTGGG + Exonic
1196278292 X:113794729-113794751 CCACCTAAAAAGATGACAGTAGG + Intergenic
1198675606 X:139127206-139127228 CCACCTGGTCAGAGGAAGGGAGG + Intronic
1201277029 Y:12308511-12308533 CCACATATTCAGAGGACTGTGGG - Intergenic