ID: 1031126309

View in Genome Browser
Species Human (GRCh38)
Location 7:117777167-117777189
Sequence AACACCATGCTGCTAGTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031126309_1031126311 2 Left 1031126309 7:117777167-117777189 CCTCTAACTAGCAGCATGGTGTT No data
Right 1031126311 7:117777192-117777214 TACTGAAGTAAGCAACCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031126309 Original CRISPR AACACCATGCTGCTAGTTAG AGG (reversed) Intronic