ID: 1031126309

View in Genome Browser
Species Human (GRCh38)
Location 7:117777167-117777189
Sequence AACACCATGCTGCTAGTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031126309_1031126311 2 Left 1031126309 7:117777167-117777189 CCTCTAACTAGCAGCATGGTGTT 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1031126311 7:117777192-117777214 TACTGAAGTAAGCAACCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031126309 Original CRISPR AACACCATGCTGCTAGTTAG AGG (reversed) Intronic
905037549 1:34927889-34927911 AACCACACACTGCTAGTTAGTGG - Intronic
906110725 1:43320250-43320272 AAGGCCATACAGCTAGTTAGTGG - Intronic
910426735 1:87126170-87126192 AAAGCCATGCTGCTAGTGAATGG - Intronic
910656288 1:89622200-89622222 AGCCTCATGCTGCTAGTAAGTGG - Intergenic
910715833 1:90229006-90229028 AAAAACATGCAGCTATTTAGTGG - Intergenic
912655077 1:111478673-111478695 AAATGAATGCTGCTAGTTAGTGG - Intergenic
915204724 1:154261602-154261624 CACACCATGCTGCTTGGAAGAGG - Exonic
922907010 1:229181330-229181352 GGCACCATGCTGCTGGTTTGGGG + Intergenic
923934291 1:238744843-238744865 AAAACCAAGCTGCCAGTTACAGG + Intergenic
1071948789 10:90679055-90679077 AAGATCATACTGCTAGTTGGAGG + Intergenic
1073526837 10:104190860-104190882 AAGGCCATGCATCTAGTTAGTGG - Intronic
1075475330 10:122729163-122729185 AAGGTCATGCTGTTAGTTAGGGG - Intergenic
1077622337 11:3737913-3737935 AACAGCATACTGCTATTTTGGGG + Intronic
1079849144 11:25508434-25508456 AACACAATGCTCCTAGGCAGAGG - Intergenic
1085772279 11:79336270-79336292 AAAGCAATGCAGCTAGTTAGTGG - Intronic
1085962086 11:81472966-81472988 ACCAGCATGCTGCTATTTATTGG - Intergenic
1086202071 11:84215973-84215995 AACACCTTACTGCAATTTAGTGG + Intronic
1088721480 11:112596027-112596049 GTCACCATACTCCTAGTTAGGGG - Intergenic
1089814943 11:121164473-121164495 AAGACAATGCTCCTAATTAGTGG + Intronic
1090232148 11:125115076-125115098 AACACCCTGCTCCTAGTTAAGGG - Intergenic
1091613552 12:2032064-2032086 ATCCCCATGCTGCAAGGTAGAGG + Intronic
1095922577 12:47545438-47545460 AACATCATGCAGCTAGTAAGTGG - Intergenic
1103151128 12:118639798-118639820 AAGATCATGCAGCTAATTAGTGG + Intergenic
1104878462 12:132053052-132053074 AACACCATGCTGCCAGGTGCTGG - Intronic
1107003395 13:35578216-35578238 AAGATCATGTTGCTAGTCAGTGG - Intronic
1108611364 13:52087207-52087229 AACACCATGCTGAGTGTTATAGG - Intronic
1110576406 13:77060948-77060970 GACACCACACAGCTAGTTAGTGG + Intronic
1111650871 13:91089252-91089274 AAAACCATTCAGCTGGTTAGTGG + Intergenic
1119952810 14:78763295-78763317 AAGATCACGCAGCTAGTTAGTGG - Intronic
1121894810 14:97637059-97637081 AAGCCCATGGTGCTAGTTTGAGG - Intergenic
1124595760 15:31090254-31090276 AACACCATGCAGCTGGTTGAAGG - Intronic
1127270385 15:57395812-57395834 AAGACCATGCAGCTGGTAAGTGG + Intronic
1128915312 15:71554765-71554787 AACACCATCCAGCTCTTTAGTGG + Intronic
1129733736 15:77947521-77947543 AACACGGTGAAGCTAGTTAGAGG - Intergenic
1135478206 16:22796838-22796860 AGTACCATGCTCCTAGTTATTGG + Intergenic
1136110069 16:28059189-28059211 GAAACCACGCTGCTAGTAAGAGG + Intronic
1140465506 16:75178573-75178595 AACAACATGCTCCTAATCAGTGG + Intergenic
1149164999 17:53740771-53740793 GACACCCTGCTGCTAATTAATGG + Intergenic
1149401668 17:56302863-56302885 AATACCATGCAGCTATTTAAAGG - Intronic
1150903102 17:69304703-69304725 ATCACAATGCTGCTACTTTGAGG + Exonic
1151151770 17:72094536-72094558 AACATCATACTGCTAGTAAGTGG - Intergenic
1153978534 18:10290274-10290296 AGCACCCTGCTCCTAGCTAGGGG - Intergenic
1155491232 18:26403943-26403965 ACCACCATTCTTCCAGTTAGAGG + Intergenic
1157496372 18:48160452-48160474 AAGATCATACTACTAGTTAGTGG - Intronic
1159666551 18:71168492-71168514 AACTCTATTCTGCTAATTAGAGG + Intergenic
1161516196 19:4697979-4698001 AACACCAAGCTGCTAGCAGGTGG - Intronic
925309195 2:2870221-2870243 AACCACATGCATCTAGTTAGAGG + Intergenic
926698496 2:15786990-15787012 AAGACCATACAGCTAGTTGGTGG + Intergenic
928234373 2:29527154-29527176 ATAACCATGCTGCAAATTAGCGG + Intronic
930296180 2:49557216-49557238 AGGACCATGCTGCTGGTTTGTGG + Intergenic
935298572 2:101672947-101672969 AACACTATGCTGCTAGTATATGG + Intergenic
935548783 2:104430003-104430025 AACACTATCCTGATAGTTCGAGG - Intergenic
937075641 2:119104292-119104314 AAGACCACGCAGCTAGTGAGTGG - Intergenic
939882129 2:147642598-147642620 AAGACCATGCTCCTTGTTGGAGG - Intergenic
940046107 2:149411544-149411566 AAATCCATTTTGCTAGTTAGTGG + Intronic
940354548 2:152724825-152724847 CTCTGCATGCTGCTAGTTAGGGG + Intronic
942869913 2:180722173-180722195 AACTCAGTTCTGCTAGTTAGAGG - Intergenic
1169395180 20:5222814-5222836 AACATCCTTCTGCTAGCTAGGGG + Intergenic
1172168357 20:32912958-32912980 AACACCATGCAGGAAGTTAGTGG + Intronic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
950095352 3:10326182-10326204 TACCCCATGCTGCTAGATATAGG + Exonic
950856278 3:16108573-16108595 AACACAATGCTGCCACTTAATGG + Intergenic
953510071 3:43527060-43527082 CACAGCATGCTTCTATTTAGTGG + Intronic
954038548 3:47867039-47867061 ATCACCATGCTGGTGTTTAGGGG + Intronic
956125914 3:66010784-66010806 AACACCAAGTTGGTAGTGAGTGG - Intronic
964160234 3:153637842-153637864 AACACAATGATGTTAGTTACTGG - Intergenic
964179078 3:153862335-153862357 GACACCATGCTAATAGTTATAGG + Intergenic
964416522 3:156453877-156453899 ACCACCATCCTGCTGATTAGAGG - Intronic
965613001 3:170564456-170564478 AGGGTCATGCTGCTAGTTAGAGG + Intronic
970605147 4:17672921-17672943 GACACTATGCTGCAAGATAGAGG - Intronic
973985934 4:56352968-56352990 AAAATCATTTTGCTAGTTAGTGG - Intronic
975372704 4:73607098-73607120 AACTCCTTGCTGCTATTCAGAGG + Intronic
975616850 4:76255559-76255581 AACGCCATTCAGCTAGTTAGGGG + Intronic
990326133 5:54677179-54677201 AAAGCCACGCTGCTAGTGAGTGG - Intergenic
990702486 5:58489102-58489124 AACCCCATGCTACTTGTTAAGGG - Intergenic
992981909 5:82184164-82184186 AAGATCATGCAGCTAGTAAGTGG - Intronic
997860159 5:137408825-137408847 AAGGCCATGCAGCTAGTAAGTGG - Intronic
998307046 5:141088883-141088905 AACACCATGCTGCTAGCTCATGG - Intergenic
1000269399 5:159669205-159669227 AAGATCTTGCTGCTAGTAAGGGG + Intergenic
1002185566 5:177453339-177453361 AACACGATGCTGCCAGTCACTGG - Intronic
1002757549 6:176776-176798 CACACCATGCTTATAGTTGGAGG + Intergenic
1003162032 6:3644362-3644384 AACTCCATGGTGCTATTTTGTGG - Intergenic
1004983388 6:21051905-21051927 AAGATCATGCAGCTAGTTAGTGG + Intronic
1008717497 6:54306783-54306805 AAAGACATGCTGCTAGTCAGTGG + Intergenic
1008759885 6:54841310-54841332 AAAACCATGCTGGTATTTACTGG - Intergenic
1011285253 6:85715841-85715863 AAAACCAAGCTGCTAGTTCCAGG - Intergenic
1011506834 6:88054539-88054561 AAGTTGATGCTGCTAGTTAGAGG + Intronic
1014204738 6:118645385-118645407 ACCACCATGCTGCCTGGTAGTGG - Intronic
1018664213 6:166119515-166119537 AAGAAAATGCAGCTAGTTAGTGG - Intergenic
1018862999 6:167725176-167725198 TACACCATCCTGCTAGTCAAAGG + Intergenic
1019969259 7:4526951-4526973 AACACCATGAATCAAGTTAGTGG - Intergenic
1021088994 7:16459033-16459055 AACAGCATGTTGCCAGTTATTGG + Intergenic
1023251817 7:38271508-38271530 AACTCAATGATGCTAGTTTGGGG + Intergenic
1026441022 7:70444205-70444227 AACAACATGCTTCATGTTAGTGG + Intronic
1027513699 7:79114783-79114805 ACCACCACACTGCTTGTTAGTGG + Intronic
1029802618 7:102965158-102965180 AATTCTATGCTGCTAGTTAGGGG + Intronic
1030656088 7:112169574-112169596 AACATCATGCCACTAGTTAAGGG + Intronic
1031126309 7:117777167-117777189 AACACCATGCTGCTAGTTAGAGG - Intronic
1034754141 7:153598694-153598716 GACCCCATGCTGCTAGGTATGGG - Intergenic
1043108177 8:76141488-76141510 AACACCATGCTACTTGTTGCTGG - Intergenic
1047516572 8:125560006-125560028 AACATGAGGCAGCTAGTTAGTGG + Intergenic
1048177794 8:132168815-132168837 AACCCAATGCTACTAGATAGGGG - Intronic
1048730587 8:137436157-137436179 AAGAGCAGGCTTCTAGTTAGTGG - Intergenic
1049300651 8:141867718-141867740 AACGCCATGCTGCTGGACAGAGG - Intergenic
1050073328 9:1839136-1839158 CAGACCATGCTGCTTGTCAGTGG + Intergenic
1051109397 9:13618322-13618344 AAATACCTGCTGCTAGTTAGTGG + Intergenic
1052335224 9:27312354-27312376 CAGACCATGCAGCTGGTTAGTGG - Intergenic
1059785279 9:117575523-117575545 TACACCATGCTATAAGTTAGGGG + Intergenic
1060793488 9:126500516-126500538 AACCCCATGCTGCTGGTCTGGGG - Intronic
1061604450 9:131698357-131698379 AAGATCATGCAGCTAGTAAGTGG - Intronic
1187073620 X:15912789-15912811 AACATGATGCTGCTAGGAAGAGG - Intergenic
1187101831 X:16200806-16200828 AACATCATGTAGCTAGTTAGTGG - Intergenic
1192192047 X:68996805-68996827 AACATCATGCAGCTAGAAAGTGG + Intergenic
1192286986 X:69748697-69748719 AAGACCATGCTGCGGGTAAGTGG - Intronic
1194909434 X:99621857-99621879 AATGCCATGGTGCTAGTTTGAGG + Intergenic
1194950549 X:100120820-100120842 AACACCATGTTGCCAGTGATTGG - Intergenic
1197867799 X:131036974-131036996 AAAATCATGTAGCTAGTTAGTGG + Intergenic
1198135175 X:133742316-133742338 AACACCATGCTCTTAGTGTGGGG + Intronic