ID: 1031126688

View in Genome Browser
Species Human (GRCh38)
Location 7:117781646-117781668
Sequence GGGTATCGCTTAGACCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031126678_1031126688 11 Left 1031126678 7:117781612-117781634 CCTGTAGTCCCAGCTACTCGGGA 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
Right 1031126688 7:117781646-117781668 GGGTATCGCTTAGACCCAGGAGG No data
1031126682_1031126688 2 Left 1031126682 7:117781621-117781643 CCAGCTACTCGGGAGGCCGAGGC 0: 1213
1: 99956
2: 264337
3: 222921
4: 228949
Right 1031126688 7:117781646-117781668 GGGTATCGCTTAGACCCAGGAGG No data
1031126680_1031126688 3 Left 1031126680 7:117781620-117781642 CCCAGCTACTCGGGAGGCCGAGG 0: 1273
1: 105631
2: 291249
3: 232794
4: 263359
Right 1031126688 7:117781646-117781668 GGGTATCGCTTAGACCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031126688 Original CRISPR GGGTATCGCTTAGACCCAGG AGG Intronic
No off target data available for this crispr