ID: 1031130104

View in Genome Browser
Species Human (GRCh38)
Location 7:117823641-117823663
Sequence ATCCTTGGCTGGGGCATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031130104_1031130109 10 Left 1031130104 7:117823641-117823663 CCTTTGATGCCCCAGCCAAGGAT 0: 1
1: 0
2: 1
3: 13
4: 154
Right 1031130109 7:117823674-117823696 AACTGATTTCTTGCTCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031130104 Original CRISPR ATCCTTGGCTGGGGCATCAA AGG (reversed) Intronic
902720617 1:18301838-18301860 CTCCCTGGCTGTGGCATCCAGGG - Intronic
902781717 1:18709220-18709242 ATCCTTGGCTGGGGTCTGGAGGG + Intronic
904900055 1:33849998-33850020 ATCTGTGGCTGGGGCATAAAGGG - Intronic
909440600 1:75691617-75691639 ATCCTTGGTTGGGGCATGGGTGG + Intergenic
919257845 1:195148354-195148376 ACTCTTGGCTGGGGAATGAAAGG - Intergenic
920542490 1:206789878-206789900 ATCCTTTGCAGGGACATGAAAGG - Intergenic
921081220 1:211739718-211739740 ATATTTGTCTGGGGAATCAAAGG + Intergenic
921149636 1:212389303-212389325 ATCCTTGGCTGGAGAACCCAGGG + Intronic
1067274550 10:44822064-44822086 AGCCTTGGCTTGGGCATCTGGGG + Intergenic
1068116921 10:52746134-52746156 GTCCTTTGCAGGGGCATGAATGG - Intergenic
1069267265 10:66476052-66476074 ATCCTTTGCTGGGACATGGATGG + Intronic
1069772039 10:70906230-70906252 ATCCCAGGCTGGGGCAGCCACGG - Intergenic
1070537592 10:77391260-77391282 ATCCTTCCCTGGGGCATCAAGGG - Intronic
1072478133 10:95783395-95783417 GTCCTTGGCTGGCACATCAAGGG + Intronic
1073054328 10:100689375-100689397 GTCCTAGGCTGGGGAAACAAGGG - Intergenic
1073135697 10:101218952-101218974 GTCCATGGCTGGGGCATCCCAGG + Intergenic
1077346855 11:2063661-2063683 ATCCTTTGCAGGGACATGAATGG - Intergenic
1083530535 11:63417856-63417878 TTCCCTGGCTGTGGCACCAATGG - Intergenic
1084055067 11:66626673-66626695 ATCCTGGGATGGGGCACCACAGG + Exonic
1084787710 11:71453153-71453175 CTCCTTGGCCGGAGCCTCAACGG + Exonic
1084856934 11:71995466-71995488 ATCCGTGGCTGGTGCATCGTGGG + Exonic
1086537220 11:87862349-87862371 GTCCTTTGCTGGGGCATGGATGG + Intergenic
1087434298 11:98093747-98093769 ATTCTTGGATGGGTCATGAATGG + Intergenic
1089033169 11:115355298-115355320 ATCCTTGGCAGGAACATGAATGG + Intronic
1089642657 11:119857981-119858003 ATCCTTTGTTGGGGGGTCAAGGG + Intergenic
1091632538 12:2172878-2172900 AGCCTTGGCTGGGGCCTCATGGG + Intronic
1099795148 12:87391078-87391100 TTCCTTGGCAGGTGCATCATTGG - Intergenic
1100932995 12:99632129-99632151 AGCCATGGCTGGGGCAACCATGG - Intronic
1104543766 12:129692687-129692709 ATCCTTTGCAGGGGCATGGATGG + Intronic
1106181785 13:27375760-27375782 ATCCTTGCCTGGGCCAACTATGG - Intergenic
1108976220 13:56446285-56446307 GTCCTTTGCAGGGACATCAATGG - Intergenic
1111111190 13:83711743-83711765 ATCACTGGCTGGCACATCAATGG - Intergenic
1113601444 13:111572105-111572127 ATCCCTTCCTGGGGCCTCAAGGG + Intergenic
1118669429 14:68106822-68106844 ATCAATGCCTGGGGCATAAAAGG - Intronic
1121717311 14:96085419-96085441 CTCCTGGGCTGGGGCAGGAAGGG + Intronic
1124016194 15:25877751-25877773 ATCCTTGACTGGGTCGTGAAAGG + Intergenic
1125119541 15:36138014-36138036 GTCCTTGGCTGGGACATGGATGG - Intergenic
1126773614 15:52081003-52081025 ATTCTAGTCTGGGGCAGCAAAGG + Intergenic
1127943662 15:63727448-63727470 ATCCTGGGCTGGAGCATAAAAGG - Intronic
1128805236 15:70526004-70526026 ATCTATGCCTGGGGCATCAAGGG + Intergenic
1129095479 15:73202440-73202462 CTCCTTGGATGGGGCATAAGAGG + Intronic
1129178386 15:73856311-73856333 AGCCCTGACTGGGGCATCAGGGG - Intergenic
1132686153 16:1162969-1162991 ATCCTTGGCTCCAGCCTCAAAGG + Intronic
1134209853 16:12267084-12267106 TTCCTTGGCTTGGGTATCACTGG + Intronic
1138637466 16:58352468-58352490 ATCCCTGGTTGGGGCATCAGTGG + Intronic
1141042514 16:80684304-80684326 GACCTTGGCTGGAGCATCAGAGG + Intronic
1141804558 16:86334246-86334268 CTCATTGGCTGGGGCGTCACAGG + Intergenic
1142675740 17:1512094-1512116 ATTCTTGGCTGGGGAAAGAAGGG + Intronic
1145060194 17:19728355-19728377 ACCCTTGGCTGGAGAATCAGCGG + Intergenic
1145304806 17:21667963-21667985 ATCCTGGGCTGGGGCACAGAGGG - Intergenic
1148130062 17:45257062-45257084 ATCCTAGGCTGGGGGATCCTAGG + Intronic
1148450594 17:47775360-47775382 ATGCTTGGGTGGGGCAGGAAAGG - Intergenic
1150868849 17:68882066-68882088 ATGCATGGCTGGGGCAACAAAGG - Intronic
1151604208 17:75125954-75125976 GTCCTTGGCGGGGGCACCATGGG + Intronic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1152960636 18:78470-78492 ATTCTTGGCTGGCTCACCAAGGG - Intergenic
1153137843 18:1937687-1937709 ATCCTTTGCAGGGGCATGGATGG - Intergenic
1153715541 18:7844053-7844075 ATCCAAGGCTGGGTCATGAACGG - Intronic
1153722073 18:7915110-7915132 ATTCTTGGCTTTGGGATCAAAGG + Intronic
1158646149 18:59249468-59249490 TTCCTTGGCTGGGAAATAAAGGG - Intergenic
1158705517 18:59788982-59789004 ATATTTGACTGGAGCATCAAAGG - Intergenic
1161535234 19:4815124-4815146 AACCTTGGTGGGGGCATCAAAGG + Intergenic
1164647120 19:29867148-29867170 AACCTTGGCTGGCGCATCATAGG - Intergenic
1164709938 19:30348621-30348643 ATCCAGGGCTGGGACATGAAAGG + Intronic
1164965541 19:32479893-32479915 CTCCTAGGCTGGGGCAGCATTGG - Intronic
1166249401 19:41557215-41557237 ATCCTTAGCTGTGGAAACAAGGG - Intronic
1166337818 19:42119220-42119242 ATCCCTGGCAGGGGCATTAAGGG + Intronic
1168632845 19:57971010-57971032 AGTCCTGGCTGGGGTATCAAAGG - Intronic
925235426 2:2273170-2273192 TTCCTCTGCTGGGGCACCAATGG + Intronic
926285843 2:11487467-11487489 AGCCTTGGCTGGGGACTCAAGGG - Intergenic
927145423 2:20162413-20162435 ATTCCTGGCTTGGGCAGCAAAGG + Intergenic
929448724 2:42021703-42021725 AGCTTTGGCTGGGGCACCCAAGG + Intergenic
930371579 2:50508160-50508182 ATCCTTGGCTGGTGTATCTCAGG + Intronic
935187051 2:100743972-100743994 ATCGTTGGCTGGGGCAGAATTGG + Intergenic
935281474 2:101521629-101521651 ATCCTTGAATGGGTCATCACAGG + Intergenic
939861936 2:147431318-147431340 ATCCTGGGCTGAGTCATCAGGGG - Intergenic
940438534 2:153684955-153684977 ATCCTTTGCAGGGACATGAATGG - Intergenic
941497104 2:166219409-166219431 ATCCTTTGCAGGGACATGAATGG + Intronic
945003623 2:205378164-205378186 ATCCTTTGCAGGGGGACCAAGGG + Intronic
945032293 2:205677200-205677222 ATGCATGGATGGGGCTTCAATGG - Intergenic
945997594 2:216451021-216451043 TTCCTTGGCTGCAGCATCCAGGG - Exonic
947300534 2:228683954-228683976 TTTCTCGGCAGGGGCATCAAGGG - Intergenic
947523773 2:230866354-230866376 AGTCTTGCCTGGGGCATTAAGGG + Intronic
947705659 2:232273541-232273563 ATTATTTGCTGGGGCATCCAGGG + Intronic
1173723915 20:45283648-45283670 ATCCTGGGCTGGGACCTGAAAGG + Intergenic
1175297006 20:57915373-57915395 ATGCTTGGCTGTAGCAGCAAAGG + Intergenic
1175945679 20:62557712-62557734 ATCCTGCCCGGGGGCATCAAAGG - Intronic
1176656120 21:9590401-9590423 ATCCTGGGCTGGGGCACAGAGGG - Intergenic
1177575710 21:22952398-22952420 ATCTTTGTCTGGGGTATCCATGG + Intergenic
1178481772 21:32985734-32985756 TAACTTGGCTGGGTCATCAAGGG + Intergenic
1179775927 21:43662188-43662210 ATCCTGGGCTGGCTCACCAAAGG - Intronic
1180832851 22:18914884-18914906 ATTCATGGCTGGGGCAGTAAAGG - Intronic
1182623069 22:31628341-31628363 ATCTTTGGCTTGGGCTTCCAGGG - Intronic
1182855302 22:33511831-33511853 ATCTCTGGCTGTGGAATCAAAGG - Intronic
1183645014 22:39120327-39120349 TTCCATAGCTGGGGCATCACTGG + Intronic
1184038990 22:41932489-41932511 ATCCTTGCCTGGGTCTTCATGGG + Intergenic
1184190895 22:42893659-42893681 GTCCTTGGCTGTGGCACAAATGG + Intronic
1184261801 22:43321639-43321661 AGCCTGGGCTGGGTCACCAAAGG + Intronic
1185368487 22:50447684-50447706 CTCCTGGGCTGGGACAGCAAGGG - Intronic
1203282936 22_KI270734v1_random:140188-140210 ATTCATGGCTGGGGCAGTAAAGG - Intergenic
949657508 3:6237983-6238005 AGCCATGGCTGGTGCAGCAAAGG - Intergenic
950353921 3:12387020-12387042 ATCCTTTGCAGGGGCATGGATGG - Intronic
951098799 3:18662848-18662870 ATACTGGGCTGGGGCTACAAAGG - Intergenic
952004905 3:28832406-28832428 ATCCTTTGCAGGGACATGAATGG + Intergenic
953356093 3:42257384-42257406 CTCCTTAGCTGGGGCATAAGGGG + Intergenic
954642929 3:52112826-52112848 ATCCTGGGCAGGGGAATTAAGGG - Intronic
954671296 3:52292637-52292659 ATCCATGGCTGGGGCTTCTGTGG + Exonic
959664499 3:108905673-108905695 ATCCTAGGCTAGGGGAGCAAAGG - Intergenic
961572011 3:127806028-127806050 ATTCTTGGCTGGGGCCTCAGTGG + Intronic
963922311 3:150917498-150917520 ATGCTTGGGTGGTGCCTCAAAGG - Intronic
964052141 3:152407819-152407841 ATCCTTTGCAGGGACATGAATGG + Intronic
965610117 3:170535017-170535039 CTCCCTGACTGGGGCATCGAAGG - Intronic
968588981 4:1448434-1448456 AGCCTGGGCTGGGGCCCCAAGGG - Intergenic
969836619 4:9847592-9847614 AACCCATGCTGGGGCATCAATGG + Intronic
971135849 4:23867723-23867745 ATCCTGGGCTGGGGAATGATGGG - Intronic
972638280 4:40903531-40903553 GCCCTTTGCTGGTGCATCAAGGG - Intronic
973701302 4:53539912-53539934 GTCCTTGCATGGGGCATCCATGG + Intronic
976377495 4:84362277-84362299 AGCCGTGGCTGGGGCATCTGTGG - Intergenic
976408281 4:84684073-84684095 ATCCATGTGTGGAGCATCAATGG - Exonic
985876446 5:2602269-2602291 TTCCTAGGCTGTGGCATCACTGG - Intergenic
989998195 5:50860788-50860810 ATCTTTGGCTGGGGAATGAGGGG + Intergenic
992356456 5:75989434-75989456 ATCCTTTGCAGGGACATAAATGG - Intergenic
992749414 5:79848749-79848771 TTCCTGGGCTTGGGTATCAACGG - Intergenic
996119740 5:119657603-119657625 GTCCTTTGCAGGGGCATCGATGG - Intergenic
996698906 5:126429223-126429245 ATCCTTTGCAGGGACATGAATGG + Intronic
997043376 5:130283558-130283580 TTCCTAGGCTGGGACACCAAGGG - Intergenic
997666083 5:135630444-135630466 ATCCTTGACTTGAGCATCCAGGG + Intergenic
999573438 5:152946716-152946738 ATCCTTGGTGGGGGCATGCAGGG - Intergenic
1001643905 5:173265679-173265701 ATTGCTGGCTGGGGCTTCAAGGG + Intergenic
1002506274 5:179681250-179681272 ATTCTTGGCAGGGGAATGAAGGG + Intronic
1004755044 6:18601789-18601811 GTTCTTTGCTGGGGCTTCAAAGG + Intergenic
1005716069 6:28549751-28549773 AGCCATGGCTGGAGCATCCAAGG - Intergenic
1007071196 6:39039570-39039592 AGTCTTGGATGTGGCATCAAAGG + Intergenic
1007752363 6:44078023-44078045 TTCCTTTGCTAGGGCATAAAGGG + Intergenic
1011080481 6:83485591-83485613 ATCCTTTGCAGGGACATGAATGG + Intergenic
1012688777 6:102287536-102287558 ATCCTTTGCAGGGACATGAATGG + Intergenic
1014187611 6:118453778-118453800 AAACTTGGCTGCAGCATCAAAGG + Intergenic
1014946554 6:127505357-127505379 ATCCTTTGCAGGGACATGAATGG + Intronic
1015356628 6:132285098-132285120 AACCTTGGCTGGAGCTTCGAGGG - Intergenic
1022718897 7:32924898-32924920 ATCGTTGCCTAGGGCATCAATGG + Intergenic
1023865235 7:44235237-44235259 CTCCTTGGCTCAGGCACCAAGGG + Intronic
1026534397 7:71228194-71228216 CTGCTTGGCTGGGACATCAGGGG - Intronic
1030221722 7:107105570-107105592 ATCCTTGCCTGCTACATCAAGGG + Intronic
1031130104 7:117823641-117823663 ATCCTTGGCTGGGGCATCAAAGG - Intronic
1031890388 7:127287250-127287272 CCCCTTGGCTGGGGGAACAAAGG + Intergenic
1031893017 7:127317066-127317088 ATCCTTTGCAGGGACATGAATGG + Intergenic
1034238994 7:149595320-149595342 ATCCTTGGGTGTGGCAACACAGG - Intergenic
1036405728 8:8453707-8453729 TTCCTCAGCTGGGGGATCAAGGG - Intergenic
1036499068 8:9296717-9296739 ATGCATGGCTGAGGCAACAATGG - Intergenic
1040685518 8:49867767-49867789 ATCCTTGGCAGGGACATGGATGG + Intergenic
1042038799 8:64569242-64569264 ATTCCTGGCTGGAGCATCTAAGG + Intergenic
1042586137 8:70340770-70340792 ATCCTTTGCAGGGACATGAATGG + Intronic
1046334057 8:112759277-112759299 TTCCTAGGATGGGTCATCAAAGG - Intronic
1046392138 8:113588604-113588626 ATCCTTTGCAGGGGCATGGATGG + Intergenic
1046461554 8:114543676-114543698 ATCCTTCTCTGGGGTATCTATGG + Intergenic
1048320857 8:133399291-133399313 GTCCTTTGCAGGGACATCAATGG - Intergenic
1057870494 9:98713359-98713381 ATACTTGGCAGAGGCAGCAAGGG + Intergenic
1062617349 9:137403807-137403829 AGCCCAGGCTGGGGCATCCACGG - Intronic
1062737457 9:138145235-138145257 ATTCTTGGCTGGCTCACCAAGGG + Intergenic
1203633837 Un_KI270750v1:93861-93883 ATCCTGGGCTGGGGCACAGAGGG - Intergenic
1185556042 X:1022054-1022076 ATCCTTTGCAGGGGCGTCGATGG + Intergenic
1186397232 X:9222388-9222410 TTCCTTGGCTGTGGCAAGAAGGG + Intergenic
1189435051 X:40985129-40985151 GTCCTTTGCAGGGACATCAATGG - Intergenic
1192757935 X:74066080-74066102 ATCCCTGGCTGGGGGAGCATGGG - Intergenic
1194887536 X:99335349-99335371 GTCCTTTGCAGGGACATCAATGG - Intergenic
1195459454 X:105107662-105107684 CTTTTTGGCTGGGGCAACAATGG + Intronic
1197704386 X:129623297-129623319 ATACTTGGCTGGGGCCTTCAAGG - Intergenic
1201303280 Y:12528711-12528733 ATCCTTGGCTTTGGCAGCACTGG + Intergenic
1201516753 Y:14826113-14826135 ATTCTTGGCTGTGGCCTAAAAGG + Intronic