ID: 1031134344

View in Genome Browser
Species Human (GRCh38)
Location 7:117869938-117869960
Sequence CACTGAAAACCCTTCGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031134339_1031134344 16 Left 1031134339 7:117869899-117869921 CCATATAGCTGAGACCAGAATGG 0: 1
1: 0
2: 1
3: 7
4: 143
Right 1031134344 7:117869938-117869960 CACTGAAAACCCTTCGCATATGG No data
1031134342_1031134344 2 Left 1031134342 7:117869913-117869935 CCAGAATGGGAACCTCTATGCTC 0: 1
1: 0
2: 2
3: 10
4: 95
Right 1031134344 7:117869938-117869960 CACTGAAAACCCTTCGCATATGG No data
1031134343_1031134344 -10 Left 1031134343 7:117869925-117869947 CCTCTATGCTCATCACTGAAAAC 0: 1
1: 0
2: 1
3: 15
4: 174
Right 1031134344 7:117869938-117869960 CACTGAAAACCCTTCGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031134344 Original CRISPR CACTGAAAACCCTTCGCATA TGG Intronic
No off target data available for this crispr