ID: 1031136448

View in Genome Browser
Species Human (GRCh38)
Location 7:117889559-117889581
Sequence CTGTGTGATCAAACGGCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031136448_1031136457 18 Left 1031136448 7:117889559-117889581 CCAAATGCCGTTTGATCACACAG No data
Right 1031136457 7:117889600-117889622 GTCACCAGATAGTTCAGTTGGGG No data
1031136448_1031136456 17 Left 1031136448 7:117889559-117889581 CCAAATGCCGTTTGATCACACAG No data
Right 1031136456 7:117889599-117889621 GGTCACCAGATAGTTCAGTTGGG No data
1031136448_1031136455 16 Left 1031136448 7:117889559-117889581 CCAAATGCCGTTTGATCACACAG No data
Right 1031136455 7:117889598-117889620 AGGTCACCAGATAGTTCAGTTGG No data
1031136448_1031136452 -4 Left 1031136448 7:117889559-117889581 CCAAATGCCGTTTGATCACACAG No data
Right 1031136452 7:117889578-117889600 ACAGGAAGATGGCATTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031136448 Original CRISPR CTGTGTGATCAAACGGCATT TGG (reversed) Intergenic
No off target data available for this crispr