ID: 1031137832

View in Genome Browser
Species Human (GRCh38)
Location 7:117904504-117904526
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031137828_1031137832 -4 Left 1031137828 7:117904485-117904507 CCACTCTGCGCTCTTTGAGTTGA No data
Right 1031137832 7:117904504-117904526 TTGAATAAGAAAGGGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031137832 Original CRISPR TTGAATAAGAAAGGGCAGGA AGG Intergenic
No off target data available for this crispr