ID: 1031138093

View in Genome Browser
Species Human (GRCh38)
Location 7:117908050-117908072
Sequence GAGTTTATCTGGAGGAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031138093_1031138097 -10 Left 1031138093 7:117908050-117908072 CCCTCACTCCTCCAGATAAACTC No data
Right 1031138097 7:117908063-117908085 AGATAAACTCCATTACCTGTTGG No data
1031138093_1031138098 -9 Left 1031138093 7:117908050-117908072 CCCTCACTCCTCCAGATAAACTC No data
Right 1031138098 7:117908064-117908086 GATAAACTCCATTACCTGTTGGG No data
1031138093_1031138101 24 Left 1031138093 7:117908050-117908072 CCCTCACTCCTCCAGATAAACTC No data
Right 1031138101 7:117908097-117908119 AAATGAATCCATTGCAGTAATGG No data
1031138093_1031138102 25 Left 1031138093 7:117908050-117908072 CCCTCACTCCTCCAGATAAACTC No data
Right 1031138102 7:117908098-117908120 AATGAATCCATTGCAGTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031138093 Original CRISPR GAGTTTATCTGGAGGAGTGA GGG (reversed) Intergenic
No off target data available for this crispr