ID: 1031145871

View in Genome Browser
Species Human (GRCh38)
Location 7:117996011-117996033
Sequence CGAGATCTGATGGGTTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031145867_1031145871 20 Left 1031145867 7:117995968-117995990 CCAGTCTTTCCTGTGCTAGTCTC No data
Right 1031145871 7:117996011-117996033 CGAGATCTGATGGGTTTTCCAGG No data
1031145868_1031145871 11 Left 1031145868 7:117995977-117995999 CCTGTGCTAGTCTCATGATCTTG No data
Right 1031145871 7:117996011-117996033 CGAGATCTGATGGGTTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031145871 Original CRISPR CGAGATCTGATGGGTTTTCC AGG Intergenic
No off target data available for this crispr