ID: 1031147240

View in Genome Browser
Species Human (GRCh38)
Location 7:118010365-118010387
Sequence CATTATAACCATAAGAAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031147238_1031147240 21 Left 1031147238 7:118010321-118010343 CCAAGAACTGCTCTGAGCATTTT No data
Right 1031147240 7:118010365-118010387 CATTATAACCATAAGAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031147240 Original CRISPR CATTATAACCATAAGAAGGT AGG Intergenic
No off target data available for this crispr