ID: 1031154450

View in Genome Browser
Species Human (GRCh38)
Location 7:118093525-118093547
Sequence TAAAACCCCCAAATTTATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031154445_1031154450 11 Left 1031154445 7:118093491-118093513 CCTGAGAATCTTTCCTCCCTTTC No data
Right 1031154450 7:118093525-118093547 TAAAACCCCCAAATTTATCAAGG No data
1031154446_1031154450 -2 Left 1031154446 7:118093504-118093526 CCTCCCTTTCCATTTTAGTAATA No data
Right 1031154450 7:118093525-118093547 TAAAACCCCCAAATTTATCAAGG No data
1031154448_1031154450 -6 Left 1031154448 7:118093508-118093530 CCTTTCCATTTTAGTAATAAAAC No data
Right 1031154450 7:118093525-118093547 TAAAACCCCCAAATTTATCAAGG No data
1031154447_1031154450 -5 Left 1031154447 7:118093507-118093529 CCCTTTCCATTTTAGTAATAAAA No data
Right 1031154450 7:118093525-118093547 TAAAACCCCCAAATTTATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031154450 Original CRISPR TAAAACCCCCAAATTTATCA AGG Intergenic
No off target data available for this crispr