ID: 1031156650

View in Genome Browser
Species Human (GRCh38)
Location 7:118118927-118118949
Sequence CCATACATGCAAAAGTTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031156650_1031156655 13 Left 1031156650 7:118118927-118118949 CCTTTTAACTTTTGCATGTATGG No data
Right 1031156655 7:118118963-118118985 AATTAAAACTGATAATGGTCTGG No data
1031156650_1031156654 8 Left 1031156650 7:118118927-118118949 CCTTTTAACTTTTGCATGTATGG No data
Right 1031156654 7:118118958-118118980 ACAAAAATTAAAACTGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031156650 Original CRISPR CCATACATGCAAAAGTTAAA AGG (reversed) Intergenic
No off target data available for this crispr