ID: 1031164803

View in Genome Browser
Species Human (GRCh38)
Location 7:118214985-118215007
Sequence CTGAAAACACAGCTGGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 351}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031164803_1031164807 2 Left 1031164803 7:118214985-118215007 CCATGTCCCAGCTGTGTTTTCAG 0: 1
1: 0
2: 1
3: 32
4: 351
Right 1031164807 7:118215010-118215032 AGTGTGGCAGCACATCTCCAAGG No data
1031164803_1031164808 3 Left 1031164803 7:118214985-118215007 CCATGTCCCAGCTGTGTTTTCAG 0: 1
1: 0
2: 1
3: 32
4: 351
Right 1031164808 7:118215011-118215033 GTGTGGCAGCACATCTCCAAGGG 0: 1
1: 0
2: 3
3: 9
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031164803 Original CRISPR CTGAAAACACAGCTGGGACA TGG (reversed) Intronic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
900805046 1:4762215-4762237 CTGCACACACAGCTAAGACATGG - Intronic
900960813 1:5918180-5918202 CTGAAAACAAAGCTCTGCCATGG + Intronic
901633981 1:10661144-10661166 CTGACAACACAGCTCAGCCAGGG + Intronic
901792038 1:11658762-11658784 CTGAACGCACAGCTGGTACTTGG - Exonic
901894911 1:12303182-12303204 CTGAAATCAAAGCTTGGAGACGG + Intronic
902653193 1:17850215-17850237 CTGAAGACATACCTGAGACAGGG - Intergenic
903339604 1:22645337-22645359 CTGAGACCACACCTGGGACTTGG - Intronic
903522804 1:23965552-23965574 CTAAAAACACTCCTGGGAAATGG - Intronic
904259817 1:29281974-29281996 ATAGAAACACAGCTGGGACCAGG + Intronic
904430353 1:30460228-30460250 CTGCACACCCAGCTGGGAGAAGG + Intergenic
905416944 1:37810145-37810167 CTGAGAACACAGCAGGAAAAGGG + Exonic
905536078 1:38722855-38722877 CTGAAAAGACAGCTGTGTCACGG - Intergenic
905548003 1:38815563-38815585 CTGAAGTCACAGCTGAGACTTGG + Intergenic
905937718 1:41838003-41838025 CTGAAAGGAGAGCTGGAACATGG - Intronic
907026992 1:51129749-51129771 CTGAAAACACAGCAAGAAAAAGG - Intronic
907249056 1:53125829-53125851 GTGTAAACAGAGCTGGAACATGG - Intronic
907930684 1:58996896-58996918 CTGAAAGCACAACTGATACAGGG + Intergenic
908490798 1:64642233-64642255 CTGAAAAAAAAGGTGGGGCAGGG - Intronic
908518341 1:64916353-64916375 ATGAAAACACAGCTGGGAAAGGG + Intronic
908525611 1:64984886-64984908 CTGCCATCACAGCTGGGCCAGGG + Intergenic
910867246 1:91799701-91799723 CTGAAAACACATCTGCAAAAAGG + Intronic
910996524 1:93110304-93110326 CTGTAAAGACAGCTTGGTCAAGG - Exonic
912415978 1:109508844-109508866 CTCAAAAAGCAGCAGGGACAAGG + Exonic
914239991 1:145846804-145846826 CAGATGACACAGCAGGGACATGG - Intronic
915556430 1:156663423-156663445 CTGGAGACACAGCTGAGTCATGG + Intergenic
918559152 1:185843556-185843578 CTAATGACACAGCTGGCACAGGG + Intronic
918646623 1:186913860-186913882 CTGCAACCACATGTGGGACAGGG - Intronic
919282153 1:195504412-195504434 AAGAAAACACAGCTGTGATAAGG - Intergenic
920049470 1:203154620-203154642 CCTAGTACACAGCTGGGACAGGG + Intronic
921568551 1:216750831-216750853 CTGAAAGCACATCAGGGAAATGG - Intronic
922322945 1:224503725-224503747 TTGAAAACACAGCTGTGGCAAGG + Intronic
924424700 1:243940653-243940675 CTGAGAACACAGCTGACACATGG - Intergenic
924728535 1:246691876-246691898 CTGAAGACACAACAGAGACAGGG - Intergenic
1062933500 10:1368347-1368369 TTGAAAACACAGCAGGGAAATGG + Intronic
1064572085 10:16704270-16704292 CTGAAATGACACCTGGTACATGG - Intronic
1064771028 10:18722981-18723003 CTCCACACACAGGTGGGACAAGG + Intergenic
1066515113 10:36150021-36150043 CTTAAAACAAAGCTGTAACACGG + Intergenic
1067036694 10:42926042-42926064 CTAAAAACACAGCTGGAATCAGG - Intergenic
1067452356 10:46390136-46390158 CTGCATACAGAGCTGGGAAATGG - Intronic
1067572736 10:47383872-47383894 CTGAAAAAACAGGGGGGAGAGGG + Intronic
1067584878 10:47469619-47469641 CTGCATACAGAGCTGGGAAATGG + Intronic
1067787971 10:49264682-49264704 CTGAATACACAGGTGTGATATGG - Intergenic
1068566234 10:58578789-58578811 CTGCACACACAGGTGGGAGAGGG - Intronic
1069322239 10:67186285-67186307 ATGAAATCACAGCTAGAACATGG - Intronic
1069912103 10:71765958-71765980 CTGAGACTCCAGCTGGGACAAGG + Intronic
1070536718 10:77384192-77384214 ATGAAATCACAGCTGGGTGATGG - Intronic
1071719578 10:88130061-88130083 CTAAAACCACAACTGGCACATGG - Intergenic
1072807584 10:98434206-98434228 CTGCCCACACAGCTGGGAAAGGG + Intronic
1072866648 10:99068994-99069016 CAGTAAAGACAGCTGGGACTTGG - Intronic
1073006470 10:100329281-100329303 CTGAGAACACAGCTGAGAACCGG - Exonic
1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG + Intergenic
1073343612 10:102764986-102765008 CTCAAAGCAGAGCTGGGCCATGG - Intronic
1075521666 10:123147272-123147294 CTTAAAACACGGGTGGGCCATGG + Intergenic
1075683242 10:124347113-124347135 CTGAAAACACCCTTGTGACAGGG + Intergenic
1075763278 10:124872655-124872677 CTGTCAACAAAGCTGGGACTTGG + Intergenic
1075900285 10:126037729-126037751 CTGAAACCACAGGGTGGACAGGG + Intronic
1076413331 10:130267089-130267111 CTGAAAACAAAGCCAGGGCAGGG - Intergenic
1077209828 11:1364783-1364805 CTGGAAACACTGCTGGTACCAGG + Intergenic
1077701231 11:4444060-4444082 CAGCTAACACAGCTGGGACCAGG + Intergenic
1078281886 11:9910751-9910773 TAGAAAACACAGCTGGGGCTGGG + Intronic
1078352517 11:10606229-10606251 CTCACAACCCCGCTGGGACAAGG + Intronic
1078430146 11:11281989-11282011 CTGGGAACACATCTGGGATATGG + Intronic
1079081393 11:17415723-17415745 CTGCACAAACAGCTGGGGCAAGG + Intronic
1079111425 11:17607318-17607340 CTGAACACACAGCCTGAACAGGG - Intronic
1080604888 11:33857144-33857166 ATTAAAACACAGGTGGGGCACGG + Intergenic
1080607573 11:33876348-33876370 CTGAAGACACAACTGGGAACAGG - Intronic
1080646026 11:34188308-34188330 CTGAGGACACAGCAGGAACAGGG + Intronic
1080935138 11:36855356-36855378 CTGAACACAGAGCTAGTACATGG - Intergenic
1080984553 11:37445902-37445924 GTGAAAAATCTGCTGGGACAAGG + Intergenic
1081566487 11:44264067-44264089 CTGAGAACACAGATGCCACAAGG - Exonic
1083120109 11:60503837-60503859 CTGAAAATAGAGCAGGCACATGG - Intronic
1083298817 11:61729515-61729537 CTGAAACCACAGCTGGCAGCCGG + Intronic
1084096586 11:66915443-66915465 CTGGAGACACAGCAGGGAGAAGG - Intronic
1084217662 11:67659003-67659025 AAGAAAACACAGCTGGGCCCAGG + Intergenic
1084576745 11:69993554-69993576 CTGAAGACCGAGCTGGGACTAGG - Intergenic
1085170609 11:74446658-74446680 CTCACAAGTCAGCTGGGACAGGG + Intergenic
1085225083 11:74912441-74912463 CTGACAACCCTGCTGGGCCAGGG + Intronic
1088540436 11:110908240-110908262 CTGAACACACACCTGTGCCAGGG - Intergenic
1089602532 11:119624362-119624384 CTCTAAACACAGCTGGGGCCAGG + Intronic
1090235533 11:125144104-125144126 CTAAAACAACACCTGGGACATGG + Intergenic
1091061864 11:132471198-132471220 CAAAAAACACAGCTGGGAGGAGG + Intronic
1092863917 12:12743539-12743561 GAGAAAACAAAGCAGGGACAAGG - Intronic
1094169857 12:27480225-27480247 CTGCCAGCACAGCTGGAACAAGG - Intronic
1094211899 12:27901677-27901699 CACAAAAGAGAGCTGGGACATGG - Intergenic
1094307798 12:29040260-29040282 CTGAAATCAGAGGTGGGCCAGGG + Intergenic
1097954681 12:65471300-65471322 ATGAAAACTCAACTGGGAGAAGG + Intronic
1098904247 12:76145554-76145576 CTGAACACATAGCTGGGAGATGG - Intergenic
1099608619 12:84836909-84836931 CTAAAAACAGAGTTGGGAAATGG + Intergenic
1101728827 12:107410037-107410059 CTGGAACCTCAGCTGGGCCAGGG - Intronic
1102529155 12:113533257-113533279 CTGGAACCACAGCCGGGAGATGG - Intergenic
1103898517 12:124290875-124290897 CAGATCACACAGCCGGGACATGG + Intronic
1103991804 12:124804359-124804381 CAGAAAACTGAGCTGGGACTTGG + Intronic
1104699130 12:130888226-130888248 CAGAACACATAGCTGTGACATGG + Intergenic
1105562457 13:21506811-21506833 CTGAAAATACAGGAGTGACAGGG - Intronic
1106101641 13:26698520-26698542 CTGAAAAATCAGCTGGCAAAAGG - Intergenic
1106586932 13:31065661-31065683 CTCAAAAGACACCTGGGATAAGG - Intergenic
1106677638 13:31978036-31978058 TGGAAAACACAGGTGGAACATGG - Intergenic
1108023027 13:46148323-46148345 CTCCAAACACAACTGGGACCTGG + Intronic
1108266234 13:48711764-48711786 CTGAAATCTCATCTGGGAAAGGG + Intergenic
1110143545 13:72160946-72160968 ATGAAAACACTCATGGGACATGG + Intergenic
1110822874 13:79936671-79936693 CTGAAAACAAGACTGAGACAGGG + Intergenic
1112465009 13:99636394-99636416 TTGAAAACAGAGGTGGGACCTGG + Intronic
1113433298 13:110268723-110268745 CTCTTAACACAACTGGGACAAGG + Intronic
1113489873 13:110682915-110682937 TTTAAAACACAGCTGTGACCTGG + Intronic
1114672255 14:24417506-24417528 CTGAGAGCACTGCTGGGACAGGG - Exonic
1116213673 14:41981682-41981704 CTGAAGACACAGATAGGTCATGG - Intergenic
1117715344 14:58574460-58574482 CTGCAAAAACTGCTGAGACAAGG + Intergenic
1118906161 14:70024955-70024977 ATGAAAACACAGCAGGGTAAGGG + Intronic
1120256936 14:82132496-82132518 CAGAAAAAACAGGAGGGACAAGG - Intergenic
1120970780 14:90205163-90205185 CTGAAATCTCAGCTCGGACAGGG + Intergenic
1202853547 14_GL000225v1_random:36542-36564 CTGAAAACAAATCTGGAACCTGG - Intergenic
1123889995 15:24768145-24768167 CTGAAAAATCAGCTGGCAAAAGG + Intergenic
1124047040 15:26160065-26160087 ATGAAAACACAGATGCGAGAAGG + Intergenic
1124895833 15:33776637-33776659 CAGAAAGCACAGTGGGGACAGGG - Intronic
1125013605 15:34907980-34908002 CAGAAAGCACAGCTAGGATAGGG - Intronic
1128385494 15:67145271-67145293 CTCATAGCACAGCTGGGACTTGG + Intronic
1128570835 15:68731610-68731632 ATGGAACCAGAGCTGGGACAGGG + Intergenic
1129606291 15:77026682-77026704 CTGAAAGCCCAGCTGGCAGATGG - Intronic
1130181161 15:81629899-81629921 CTGAAGAAACAGCTGGGAAGAGG - Intergenic
1131008583 15:88998816-88998838 CTGAAAAAACAGCTGACAAAAGG - Intergenic
1131101303 15:89691980-89692002 CTGGAAACACAGCTGGAATATGG + Intronic
1131142049 15:89984863-89984885 TAGGAAACACAGCTGGGCCAGGG - Intergenic
1131166440 15:90145367-90145389 CTGAGTCCACAGCTGGGACCTGG + Intergenic
1131294922 15:91139445-91139467 CTAAAACCAGAGCTGGGAAATGG + Intronic
1131481717 15:92787917-92787939 ATGAGAACAGAGATGGGACAGGG + Intronic
1131656095 15:94460736-94460758 CTGAAGACACATCTCAGACATGG - Intronic
1132898245 16:2238904-2238926 CTGTGAGCACAGCTGGGACAGGG + Intergenic
1134282208 16:12827138-12827160 CTGAAGACTCAGCTGGGGAAAGG + Intergenic
1134640695 16:15827364-15827386 CTCAAGACAAAGCAGGGACATGG + Intronic
1137911043 16:52378902-52378924 GTGATGACTCAGCTGGGACAGGG - Intergenic
1138189599 16:55003656-55003678 CTGAAAACACAGCCCAGAAATGG + Intergenic
1139424285 16:66869534-66869556 GTGAACACACAGCTGGGGGAGGG + Intronic
1140028179 16:71311164-71311186 TTGAAGACACACTTGGGACAAGG - Intergenic
1140451275 16:75072769-75072791 ATGTAAACAGAGCTGTGACATGG + Intronic
1140808484 16:78554849-78554871 CTGAAGACAGAGGTGGGACCTGG + Intronic
1141538294 16:84699219-84699241 CTGAAATCACAGCTAGAAAAGGG + Intergenic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1142296979 16:89230555-89230577 ATGAAAACAGACCAGGGACACGG + Exonic
1142600490 17:1051346-1051368 CTGGGAACCCAGCTGGCACACGG + Intronic
1143718407 17:8792834-8792856 CTGGAAAGACAGATGGGACCAGG - Intergenic
1144877509 17:18409125-18409147 CTGGAAACACAGTTGTGAAAAGG - Intergenic
1145154717 17:20535277-20535299 CTGGAAACACAGCTGTGAAAAGG + Intergenic
1146259836 17:31414134-31414156 CTGGTCACACAGCTGGGAAATGG + Intronic
1146560781 17:33867888-33867910 CTGAAAGCTAAGCAGGGACATGG + Intronic
1147601861 17:41751662-41751684 CTGCAAAGACAGCTGGGAAATGG - Intergenic
1148999527 17:51742760-51742782 CTCAAAACACATCTGAGAGAGGG - Intronic
1149883694 17:60318635-60318657 CAGAAAACAAGGCTGGGACTAGG + Intronic
1150601798 17:66657473-66657495 CTGAACACCCAGCAGGGACATGG + Intronic
1150723997 17:67636762-67636784 CTGTAAACACACCAGGGACTGGG + Intronic
1151133152 17:71919220-71919242 CAGAAAACACTGATGGTACAGGG + Intergenic
1151436254 17:74099634-74099656 CAGAGATCACAGCTGGGAGATGG + Intergenic
1152349401 17:79776092-79776114 CTAAAAACAAAGCTGGGAATAGG - Intergenic
1152568834 17:81112388-81112410 CTGACAACTCAGCTGGGATTGGG + Intronic
1153225598 18:2897437-2897459 CTGTAAACACAGCAGACACAGGG + Intronic
1155031733 18:21990956-21990978 CAAATAAGACAGCTGGGACAAGG - Intergenic
1155299844 18:24419214-24419236 CTGAAAAATCAACTGGCACAAGG - Intergenic
1156488789 18:37484374-37484396 CTGAAAAAACAACTGGGGAATGG + Intronic
1159902557 18:74061058-74061080 CAGAGAACAGAACTGGGACACGG + Intergenic
1160040325 18:75339275-75339297 CACAGAACACAGCCGGGACAGGG - Intergenic
1160513738 18:79467022-79467044 CTGTAAACAGAACTGGGACCGGG - Intronic
1160686761 19:440516-440538 TGGAAAACAGAGCAGGGACACGG + Intronic
1160811699 19:1015607-1015629 CTGAGGACCCAGCTGGGCCAAGG + Intronic
1161894019 19:7066746-7066768 AAGAAAAGACAGCTGGGACTGGG + Intergenic
1162086806 19:8254358-8254380 CAGAGAGCACAGCTGGCACATGG - Intronic
1163323037 19:16585726-16585748 CTGAAAACCCACCTACGACAGGG + Intronic
1164555530 19:29248194-29248216 CAGAAAACACTGCAGGGAGAAGG + Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1166329846 19:42071438-42071460 TCGAACACACAGCTGGCACATGG + Intronic
1168113798 19:54209589-54209611 CTGGACACACAGCAGGGAGATGG + Intronic
1168351452 19:55678484-55678506 CTGGAAACACAAATGGGACATGG - Intronic
1202665483 1_KI270708v1_random:115240-115262 AAGAAAACACAGTTGGGCCAGGG + Intergenic
925123510 2:1437771-1437793 CTGAACACAGAGATGGGTCAGGG + Intronic
925979813 2:9167480-9167502 CGGAAAACAGGGCTAGGACATGG + Intergenic
926298676 2:11586966-11586988 CAGGAAACAGAGCTAGGACAGGG + Intronic
926719001 2:15944918-15944940 CTGAAAGCACAGTTGGGGTATGG + Intronic
928587221 2:32772827-32772849 CTGAAAACCCAGAGGGGACTGGG - Intronic
929227358 2:39524605-39524627 CTGAATATACAGTTGAGACATGG + Intergenic
930011235 2:46940272-46940294 CTCAAAAGACAGCAGGGTCAGGG - Intronic
930392053 2:50773695-50773717 CTCAAAATCCAGTTGGGACAGGG + Intronic
930858480 2:56044385-56044407 CTGGACAGACAGCTGGGTCAGGG + Intergenic
930896910 2:56457067-56457089 GTGAAAACATAGCTGGAATAAGG - Intergenic
930951694 2:57150413-57150435 CTGTAAACCCAACTGGGACTGGG - Intergenic
933847331 2:86336903-86336925 CGGCAAAGGCAGCTGGGACATGG - Intronic
934979208 2:98826394-98826416 CTGAAAATGCAGCCAGGACAGGG + Intronic
937831889 2:126433360-126433382 TTGAAAATAAAGATGGGACAAGG - Intergenic
938583299 2:132667693-132667715 CTGATAAGACAGCTGGGGTAGGG + Intronic
938617751 2:133017347-133017369 CTTAAAACAAAGCAGGGTCAGGG + Intronic
940285654 2:152030975-152030997 CAGAAAACACAGCAGTAACAGGG + Intronic
942342197 2:174960545-174960567 ATTAAAACACAGCTGGGGCCGGG + Intronic
943785287 2:191870987-191871009 CTGAAAACAGAGATGGAACTGGG + Intergenic
943793937 2:191968169-191968191 CAGATAACACAGCTGAGAAAAGG + Intronic
944951369 2:204753572-204753594 CTGATTACACAGCTGGAACTAGG - Intronic
945092979 2:206193381-206193403 AAGAAAACACAGCTGGGGCCAGG - Intronic
948331986 2:237176848-237176870 CAGAAAACAGAGCTAAGACAAGG + Intergenic
948926755 2:241103820-241103842 ATAAAATGACAGCTGGGACATGG + Intergenic
1168992242 20:2104323-2104345 CTGAGACCACAGCTGGGACTCGG - Intronic
1170745858 20:19098371-19098393 CTGCAAAGAAAGCTGGAACATGG + Intergenic
1171472332 20:25382157-25382179 CTGAAAACTCACCTGAGACCTGG + Intronic
1171571571 20:26256171-26256193 CTGAAATCTCATCTGAGACAAGG - Intergenic
1172175832 20:32971203-32971225 CTGAGGGCTCAGCTGGGACAGGG + Intergenic
1172425705 20:34854620-34854642 CTGAAAATACAGCAGGGATATGG + Intronic
1172863203 20:38073423-38073445 CAGACAACACAGCTGGGAAGGGG + Intronic
1172938624 20:38639187-38639209 ATGAAAACACAGTTGGCCCAGGG - Intronic
1173866667 20:46316920-46316942 CTGAGGCCACAGATGGGACAAGG + Intergenic
1174265540 20:49329043-49329065 AGGAAAACAGAGCTGAGACATGG - Intergenic
1174300329 20:49577392-49577414 CAGAAAATACAGCAAGGACACGG + Intergenic
1175620693 20:60444537-60444559 ATGAAAACATACCTGGGACTGGG - Intergenic
1175777901 20:61664391-61664413 CAGAAACCACAGCTGGGGCATGG + Intronic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1177315983 21:19461759-19461781 ATGAAAACACACCTGAGACTGGG + Intergenic
1177962193 21:27680936-27680958 CTAAAAACACACCAGGGACAGGG + Intergenic
1178686893 21:34718972-34718994 CTGAAGGCAGAGTTGGGACAGGG - Intergenic
1180013400 21:45066174-45066196 CTGGAAAGACTGCTGGTACAAGG + Intergenic
1180629840 22:17220843-17220865 GTGAAAACACAGAGGGGTCAGGG + Intronic
1181035542 22:20168240-20168262 CAGAACACAGAGCTGGGACTCGG - Intergenic
1181488190 22:23244820-23244842 CTGAAACCCCAGCTGGGAAGAGG - Intronic
1181849161 22:25737453-25737475 CAGAAGACACAGTTGGGTCAGGG + Intergenic
1182374421 22:29836200-29836222 CTGAAAACACAGGTCAGATAGGG + Intronic
1182633155 22:31703109-31703131 CTTAAAACACAGCAGGGGCCAGG - Intronic
1182858126 22:33535819-33535841 GTGAAAATACAGATGGGACGGGG - Intronic
1183004014 22:34885234-34885256 TTGGAAACACATCTGGGATAAGG + Intergenic
1183305162 22:37079101-37079123 CAGAAAACTCAGATGGGCCAAGG - Intronic
1184344372 22:43904011-43904033 GAGAAAAGACAGCTGGGCCAGGG + Intergenic
1184564234 22:45282353-45282375 CTGAATCCAGAGCTGGGACAGGG + Intergenic
1184918942 22:47592114-47592136 CTGAAAACTCAGATGGGTCGAGG - Intergenic
1185031995 22:48449027-48449049 CTGACCTCACAGCTGGGACGTGG - Intergenic
1185293412 22:50040456-50040478 CTGAAAACAAAACTGGTTCATGG + Intronic
949201497 3:1385735-1385757 CTTACAACACTGCTGGGACAGGG + Exonic
949295624 3:2519171-2519193 CTTGAAACACAGTTGGTACAAGG - Intronic
949690655 3:6633743-6633765 CTGCAAACACAGCTGTAACTAGG + Intergenic
950079430 3:10210600-10210622 GTGACACCACACCTGGGACATGG - Intronic
950083066 3:10237350-10237372 ATGAAAGAACAGCTGGGTCAGGG + Intronic
950113964 3:10438608-10438630 CTGAAACCACAGCAGGGGCCTGG + Intronic
950549572 3:13658026-13658048 CAGAGAACACGGCTGGGACGAGG + Intergenic
951177527 3:19618902-19618924 CTGTGAAAGCAGCTGGGACAGGG - Intergenic
952687582 3:36167815-36167837 GTGTAAACAGAGCTTGGACAGGG - Intergenic
952881951 3:37990983-37991005 GTGAAAACACTGATGGGGCAGGG + Intronic
952946604 3:38482133-38482155 ATACACACACAGCTGGGACATGG - Intronic
953114720 3:39980685-39980707 CTGAAAATCCAGCCAGGACAAGG - Intronic
953850981 3:46465177-46465199 CTGAGACCAGAGCTGGGACAGGG - Intronic
954145537 3:48632625-48632647 CAGTAGACACAGGTGGGACAGGG - Intronic
959167142 3:102794566-102794588 CTGGAAACACAGAAGGGAGAAGG - Intergenic
959533725 3:107462295-107462317 CTGAAAACATAAGAGGGACAAGG + Intergenic
959946768 3:112133418-112133440 CTGAAATTACAGATGGGCCATGG + Intergenic
960104565 3:113780541-113780563 CTTAAAACTCTTCTGGGACATGG - Intronic
961817640 3:129559486-129559508 GAGAACACACAGCTGGGAAATGG + Intronic
963043489 3:141085842-141085864 CTGCAAACAGAGCTGGCACATGG + Intronic
963091184 3:141485614-141485636 CTGAAAACAGCATTGGGACAAGG + Intergenic
964328735 3:155576421-155576443 CTTAAAACACGGCTGTGCCAAGG - Intronic
964943479 3:162189973-162189995 CTAAAAACACACCTGAGACTGGG - Intergenic
966396504 3:179509583-179509605 CTGCAAACCCAGGTGGGACAGGG - Intergenic
966498613 3:180610715-180610737 CTAAAAACCAAGCTGTGACAAGG - Exonic
967916519 3:194582550-194582572 CTAAACCCACAGCTGGAACAAGG - Intergenic
968108617 3:196022827-196022849 AAGAAAAGACAGCTGGGACCGGG - Intergenic
968264543 3:197352676-197352698 CTGCAGACACAGCGGGGGCAGGG - Intergenic
968382688 4:109185-109207 CAGAAAACACAGCAGGTGCAGGG - Intergenic
972344047 4:38177804-38177826 CTCAGAACACAGCTGCGGCATGG + Intergenic
975405409 4:73982815-73982837 CTGAAGACACAGCAGGCACTGGG - Intergenic
975846884 4:78534485-78534507 GTGAATACACAACTGGCACAGGG - Intronic
976195176 4:82525135-82525157 TTGCAAACGCAGCTGAGACAGGG + Intronic
976881544 4:89932000-89932022 CTGAAATCTCATCTGAGACAAGG + Intronic
977939036 4:102838332-102838354 CTGAACACAGAGCTGGGAAGAGG - Intronic
983739974 4:171118055-171118077 CTGGAAAGACAGATGTGACATGG + Intergenic
983861884 4:172717520-172717542 CTGAAAAGAAAGCGGGGAAAAGG + Intronic
984486944 4:180382615-180382637 ATTAAAACACAGCAGGGACTTGG + Intergenic
985275940 4:188237890-188237912 CTGGAATGACAGCTGGGATAAGG - Intergenic
987327310 5:16824078-16824100 CTGAAAACATAACTTGGAGAAGG + Intronic
987904488 5:24058369-24058391 CTGAATACACAGTTGAGAAAAGG + Intronic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988498170 5:31762236-31762258 CAGAAACCACAGCTGAGATACGG + Intronic
989734341 5:44685552-44685574 CTGGAAACTCTGCTGAGACATGG - Intergenic
989783286 5:45296364-45296386 CTGAAAAACCATATGGGACAAGG + Intronic
989823651 5:45827306-45827328 CTGTAACTACAGCTGGGGCAGGG + Intergenic
990678475 5:58215318-58215340 TTGAGACCACAGCTGGGAAAAGG + Intergenic
991575480 5:68099043-68099065 GTGAAAACAGAGATGGGTCAGGG + Intergenic
993332495 5:86617926-86617948 CTGAAAAGAAAGATGGGAAATGG - Intronic
995467650 5:112467065-112467087 CAGAAAGCAAAGATGGGACAAGG + Intergenic
995874009 5:116771303-116771325 CTGAAGACACACCTTGGACCTGG + Intergenic
996493888 5:124130872-124130894 CTGCAAACACACATGGGACCAGG + Intergenic
996798436 5:127376387-127376409 CTGAGAAGACAGCTGGCAGATGG + Intronic
997361990 5:133301030-133301052 CTGAAAACACCTGTGGCACACGG + Intronic
997653457 5:135538535-135538557 CTCAAAAAACAGATGGAACAAGG - Intergenic
997944930 5:138191704-138191726 CTGAAAGCAAAGCTGGGCCAAGG - Intronic
998500700 5:142630259-142630281 CAGCTAACACAGCTGGGACTAGG - Intronic
998838745 5:146230813-146230835 CTGAAAACACAACTGAGAGTTGG + Exonic
998939877 5:147270213-147270235 CTGAAAAAAAATCTGAGACAGGG + Intronic
999241038 5:150127462-150127484 CTAAAACCACACCTGGCACATGG + Intronic
999320104 5:150609157-150609179 CTGAATGCAGAGCTGGGAAAGGG + Intronic
1001270838 5:170310520-170310542 GTGAAGACACAGCTGGTTCAAGG - Intergenic
1001433591 5:171682522-171682544 CTGAAAGCACAGCTGAAGCAGGG - Intergenic
1001759273 5:174194120-174194142 CTGAATACACAGTAGGGACAGGG + Intronic
1002321081 5:178376417-178376439 CAGGGACCACAGCTGGGACAGGG + Intronic
1002527449 5:179822655-179822677 CTGAAAAGGCAGCTGGCCCAAGG + Intronic
1003706674 6:8539352-8539374 CTGAACGCAGAGCTGGGACTTGG + Intergenic
1005022355 6:21430294-21430316 TTGAAAATACAGGTGGGACCGGG - Intergenic
1006112608 6:31757637-31757659 CTGTGAGCACATCTGGGACAGGG + Intronic
1006787630 6:36679087-36679109 CTGGAAACCCAGCTGGGGCGAGG + Intronic
1007164975 6:39822818-39822840 CTCAGGACACAGCTGGGACAGGG + Intronic
1008065417 6:47042527-47042549 CTGAAATCACAGAAGGGAAATGG + Intergenic
1010052487 6:71523695-71523717 CTGAAAACAGAGTTTGGACTTGG - Intergenic
1010408854 6:75537651-75537673 CTGAAATCAGAGGTGGCACAAGG - Intergenic
1011471453 6:87711965-87711987 CTGAGAACACACCTGGGCCATGG - Intergenic
1012747035 6:103104692-103104714 CTGAGAAAACAACTGGAACATGG - Intergenic
1014471376 6:121819136-121819158 CTGAAGACACACCTGAGACTGGG - Intergenic
1014594831 6:123322588-123322610 TTAAAAAAAGAGCTGGGACAGGG - Intronic
1015592941 6:134839834-134839856 CTGAGACAACAGCTGGGGCATGG + Intergenic
1016589726 6:145730958-145730980 CTCTAAACACAGCAGGGAAAGGG + Intronic
1016801170 6:148170586-148170608 ATGATAACACAGTTGTGACAGGG - Intergenic
1018676210 6:166224218-166224240 CTGAGATAAGAGCTGGGACACGG + Intergenic
1019709003 7:2509894-2509916 CTGGAGACACAGCCAGGACAGGG + Intergenic
1021644456 7:22774936-22774958 CTGTACACCTAGCTGGGACATGG - Intergenic
1021707141 7:23379008-23379030 TTGAACACACTGCTAGGACAAGG + Intronic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1024965945 7:55021951-55021973 CTGAAACCAGAACTCGGACAAGG - Intronic
1025719748 7:63999121-63999143 CTAAAAGCCGAGCTGGGACAAGG - Intergenic
1025959797 7:66209961-66209983 CTGAAAATACACCTGGGGCCAGG - Intronic
1026078267 7:67193408-67193430 CTGATGACAGAGCTGGGACTTGG - Intronic
1026327146 7:69320601-69320623 CTGAACAGACTGCTGGGCCATGG - Intergenic
1026698553 7:72618563-72618585 CTGATGACAGAGCTGGGACTTGG + Intronic
1026889302 7:73972886-73972908 CAGAATACACAGCTAGGAGACGG - Intergenic
1027352921 7:77329966-77329988 CTGAGAACACATCTGAGACATGG + Intronic
1029400835 7:100344850-100344872 AAGAAAAGACAGCTGGGCCAGGG + Intronic
1029550200 7:101233285-101233307 TTGAAAACCCAGCTGGGCCATGG + Intronic
1031164803 7:118214985-118215007 CTGAAAACACAGCTGGGACATGG - Intronic
1031345307 7:120658248-120658270 TTGAAAATACAGCAGGAACAGGG - Intronic
1031805820 7:126304892-126304914 GTGAAAACAATGCTGGCACAAGG + Intergenic
1032538642 7:132685328-132685350 CTGAAATCAGAGGTGGGCCAAGG - Intronic
1033615105 7:143006788-143006810 CTGAAAACACAGCTGCCACGGGG + Intergenic
1034840009 7:154386972-154386994 CAGAAACCACAGCTGTGAGAAGG + Intronic
1035375037 7:158402122-158402144 CTCCAAACACACCTGGGAAAAGG + Intronic
1035459029 7:159028064-159028086 ATGAAAACAGAGCTTGGACGGGG - Intergenic
1036126720 8:6069787-6069809 ATGAGGACACAGCTGGGAGATGG - Intergenic
1036192749 8:6685809-6685831 CTGGAAGCTCAGCTGGGACTGGG - Intergenic
1037523757 8:19704927-19704949 GTGAAAACAGAGTTGGGAAATGG + Intronic
1039041264 8:33410854-33410876 CTGAAAGCAGAACTGGTACACGG + Intronic
1039548226 8:38424836-38424858 CTCAAAACAGAGCTGGGGAAAGG + Intronic
1039665037 8:39517017-39517039 CTCCAAACACAGATGGGACTTGG - Intergenic
1040997556 8:53417469-53417491 TTGAGGACAGAGCTGGGACATGG + Intergenic
1043803144 8:84637260-84637282 CTGAAAACACAGGTTTGAAAGGG - Intronic
1043857630 8:85279557-85279579 CTGAAAGTGCTGCTGGGACAGGG + Intronic
1044226147 8:89720859-89720881 CTCAAAACAAAGCTGATACATGG + Intergenic
1046638195 8:116696163-116696185 CTGAATCCAGAGATGGGACAGGG + Intronic
1047167382 8:122454240-122454262 CTCAAATCACAGCTGAGAGATGG + Intergenic
1048240351 8:132735238-132735260 GTGTCAACACAGCTGGGAAAGGG + Intronic
1048257522 8:132916467-132916489 TTGAAAACATATCTGGGACATGG + Intronic
1048742546 8:137578064-137578086 CTGAAAACAAATTTTGGACATGG + Intergenic
1051833420 9:21307482-21307504 CTGAAAACACTGCGTGGACCAGG - Intergenic
1053221498 9:36316829-36316851 CTGAAAGCACAGCTGTGTGAAGG + Intergenic
1053306001 9:36985384-36985406 CTGAAAACAGAACTGGAAAAGGG + Intronic
1053442159 9:38125537-38125559 GTGAGCACACAGCTAGGACAGGG - Intergenic
1056329257 9:85508470-85508492 CTGAAATAACAGATGGAACAGGG + Intergenic
1057066375 9:92055996-92056018 CTGATAACAAAGCTGGGAGAAGG + Intronic
1057138192 9:92709952-92709974 GTGAAAACACTGCGGGGAGATGG + Intergenic
1058063096 9:100519703-100519725 AAGAAATCACAGCTGGGACCAGG - Intronic
1058298748 9:103342859-103342881 CAGAAACTACAGCTGGAACATGG + Intergenic
1058666648 9:107324176-107324198 CTAAAAAAACAGTTGGGATATGG + Intronic
1058884393 9:109312517-109312539 CTGACAGCACAGCTGGGCGAGGG - Intronic
1058951872 9:109911538-109911560 CTAAGTATACAGCTGGGACATGG - Intronic
1059029233 9:110672355-110672377 CTGAAGACCCAGCTGGGGCTAGG + Intronic
1059663160 9:116421393-116421415 CTGAAAGCAGAGGTGTGACATGG - Intergenic
1059761567 9:117342688-117342710 CTGAAAACACAGTTTGAAAATGG - Intronic
1061170310 9:128948686-128948708 GGGAAAACACTGCTGGCACAGGG - Intronic
1062187905 9:135228422-135228444 CTGACCCCACAGCTGGGAGAAGG - Intergenic
1062495517 9:136829761-136829783 CTGAAAACCCATCTGAGACTTGG + Intronic
1062547770 9:137071289-137071311 CTGGAAACACAGCAGAGGCAGGG - Intergenic
1062557266 9:137119449-137119471 AAGAAAAGACAGCTGGGCCAGGG - Intergenic
1062588420 9:137261775-137261797 ATGAAAAGACAGCTGGGCCCGGG + Intronic
1185514713 X:690844-690866 CTGAAAATACAGACGGGACACGG - Intergenic
1186010597 X:5128012-5128034 CTGACAACACACCTTGGAGACGG + Intergenic
1186071061 X:5821215-5821237 CTGGAAACACAAATGGCACACGG + Intergenic
1189074213 X:37898858-37898880 CAGAAACCAGAGATGGGACATGG + Intronic
1189253164 X:39616969-39616991 CTAAAAACAGAGATGGCACATGG + Intergenic
1189559243 X:42175627-42175649 CAGAAATCACAGCTTTGACAAGG + Intergenic
1190747430 X:53332747-53332769 CTGAAAACAGAGCTTGAAAATGG - Intergenic
1194380239 X:93181666-93181688 CTGAAATCAGAGCAGGTACAAGG - Intergenic
1194687525 X:96940960-96940982 AGGAAAACACAGCTGGGGCCAGG - Intronic
1195907910 X:109863660-109863682 CTGAAAACAAAGTTAGGTCAAGG + Intergenic
1196176675 X:112646176-112646198 CTGAAGACTCTGGTGGGACAGGG + Intronic
1196859205 X:120011720-120011742 CTGAAAAAAAAGCTTGGTCATGG + Intergenic
1197722222 X:129753068-129753090 CTGAAAACACCCCTGTGCCATGG + Intronic
1198647011 X:138819573-138819595 CTGAAAGCAAACCTGGGAAATGG - Intronic
1198912875 X:141633906-141633928 CTGTGAAAACAGCTGGGAGAGGG + Intronic
1198956097 X:142132698-142132720 ATGAAAACACAGCTAAGAGAAGG - Intergenic
1201707639 Y:16954551-16954573 AAGAAAAGACAGCTGGGCCAGGG - Intergenic