ID: 1031164887

View in Genome Browser
Species Human (GRCh38)
Location 7:118216072-118216094
Sequence GTGAATGTACAAATAGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 542
Summary {0: 1, 1: 1, 2: 6, 3: 63, 4: 471}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031164887 Original CRISPR GTGAATGTACAAATAGACAA TGG Intronic
900801709 1:4741120-4741142 GTGGATGAACAAACAGAAAACGG + Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903054723 1:20627747-20627769 TTGAATGTAAAAATGGAAAAAGG - Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
907026300 1:51123390-51123412 GTGAATGGATAAATAAACTATGG - Intronic
907613627 1:55900319-55900341 ATGCATGTACACATACACAAAGG - Intergenic
909040399 1:70642727-70642749 GTGAATCCACAAACAGAAAATGG + Intergenic
909111630 1:71485813-71485835 GTGAATGAATAAATAAACTAAGG - Intronic
909245608 1:73278755-73278777 GTAAAAGTAGAAATAAACAAGGG - Intergenic
910040139 1:82840754-82840776 GTGATTGTTCAAAAAGACTAAGG + Intergenic
910196584 1:84647529-84647551 GAGAATGTACAAATCAAAAATGG - Exonic
910329286 1:86051344-86051366 GTGATATGACAAATAGACAATGG + Intronic
912065661 1:105738109-105738131 GTGAATGTATAAAAAGACTATGG - Intergenic
912579594 1:110708152-110708174 GTGTATCTGCAAATATACAAAGG + Intergenic
912596422 1:110881478-110881500 GTGAATGTATAAATAAATAGTGG - Intronic
913204578 1:116525409-116525431 GTGAATGGACAAATAAACTGTGG - Intronic
913493342 1:119403651-119403673 GTGAATGGATAAATAAACTATGG + Intergenic
914767932 1:150655694-150655716 GTTAATGAACAATTAGAAAACGG + Intronic
916352511 1:163867290-163867312 GTTAATATACAAATAGATATTGG + Intergenic
916387095 1:164286963-164286985 ATGAATGTACAAATAAAACATGG - Intergenic
917220550 1:172724112-172724134 GAGAATGGAAAAATAGACATTGG + Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917942917 1:179941144-179941166 ATGTATATACAAATAGACTATGG + Intergenic
918637240 1:186792431-186792453 ATGAATGAACAAATATATAATGG + Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918795165 1:188885169-188885191 GTGAATGGATAAATAAACTATGG + Intergenic
918819921 1:189239844-189239866 GTGAGAGAATAAATAGACAAGGG + Intergenic
919143675 1:193606157-193606179 GTGAATGGACAAATACACTGTGG + Intergenic
920160774 1:203996309-203996331 TTGAATGTGCAAATAAACAGAGG + Intergenic
920542848 1:206792424-206792446 GTGAATGTACTAAACCACAAAGG - Intergenic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
922181371 1:223235740-223235762 GTGAATGGATAAATAAACTATGG - Intronic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922546496 1:226461483-226461505 GTTAAGGTACAGATAGACCAGGG + Intergenic
922635421 1:227165235-227165257 GTGAATGTAAGAAAAGACAATGG + Intronic
923063773 1:230499808-230499830 GTGAATATACTAAAAGTCAATGG - Intergenic
923236966 1:232043365-232043387 GTGAATAAATAAATAAACAATGG - Intergenic
924240945 1:242039677-242039699 GTGAATGAAAAAATAAACAGTGG - Intergenic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924879294 1:248141560-248141582 GTTAATGTATAAAAAGACACTGG + Intergenic
1063398865 10:5721606-5721628 GTGAATAAGCAAATAGAGAAGGG + Intronic
1065277873 10:24104280-24104302 GTGAATGGATAAATAAACCATGG + Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067243746 10:44518359-44518381 CTGAATGCAGAAATAGACGATGG - Intergenic
1067336542 10:45370748-45370770 GTGCATGTATACATACACAATGG + Intergenic
1067657690 10:48209376-48209398 GTGAATCTACAGACAGACTATGG + Intronic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1068817038 10:61328365-61328387 GTGAATGTATAAATAAACTGAGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069573967 10:69512811-69512833 GTGAATGGATAAATAAACCATGG - Intergenic
1070223281 10:74473759-74473781 GGAAAGGAACAAATAGACAATGG - Intronic
1070229632 10:74551091-74551113 AAGGATGTACTAATAGACAAAGG + Intronic
1070579296 10:77707618-77707640 GAAAATGTACAGATACACAATGG + Intergenic
1071282768 10:84117552-84117574 GTGAATGCACACTTGGACAAGGG - Intergenic
1071282869 10:84118667-84118689 GTGAATGCACACTTGGACAAGGG + Intergenic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1071781294 10:88848294-88848316 GTGAATGAATAAATAAATAAAGG + Intronic
1072178922 10:92960126-92960148 GTGAATGTATAAATAAACCCTGG + Intronic
1074168744 10:110910938-110910960 GTGATGGTAAAAAGAGACAAGGG + Intronic
1074261599 10:111859241-111859263 GGGAATTTACAAATAAGCAAGGG - Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075145542 10:119879849-119879871 CTGCATATACAAACAGACAATGG - Intronic
1078644149 11:13123586-13123608 GTGAATGAATAAATAAATAATGG + Intergenic
1078999272 11:16737819-16737841 GTGAATGTACTAAGTGACAGTGG + Intronic
1079826809 11:25206361-25206383 ATGAATGTACAGATAGGCATAGG + Intergenic
1079980573 11:27147446-27147468 GTGAATGAATAAATAAACTATGG + Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081337800 11:41888521-41888543 GTAAATGTATAAAGAAACAATGG + Intergenic
1082163701 11:48915645-48915667 TTGAATGCACATATAGAAAAAGG + Intergenic
1082193405 11:49273772-49273794 GAGAATGAACAAATAGACTGGGG + Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1083034001 11:59619842-59619864 GTGAATGTACAAATAGGCTCTGG + Intergenic
1083038129 11:59659385-59659407 GTTAATGAACAAACAGGCAATGG - Exonic
1083060652 11:59867313-59867335 GCAAATGTACATATACACAATGG + Intergenic
1083837370 11:65280156-65280178 TTGAATGTAAACATTGACAAAGG - Intronic
1084195399 11:67521689-67521711 CTGAATGAACAAATATAAAAGGG + Intronic
1084467373 11:69333925-69333947 GCAAATGGACAAATGGACAAAGG - Intronic
1084785656 11:71440394-71440416 GTGGATGGACAAATAGATGACGG + Intronic
1085528619 11:77178523-77178545 CTGAATGTAGAAATAAATAAAGG - Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086825300 11:91489012-91489034 GTGAGTGCACACTTAGACAAGGG + Intergenic
1087034455 11:93741940-93741962 CTGAAGGCAGAAATAGACAAAGG - Exonic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG + Intergenic
1087711925 11:101563884-101563906 CTAAATGTACAAGTAGAAAATGG - Intronic
1088492203 11:110399194-110399216 GTTAATGAACAATTAGAAAATGG + Intergenic
1088622782 11:111703759-111703781 GTAAATGTGCAGATAGGCAAAGG + Intronic
1090067405 11:123514976-123514998 GTGAATGAACAAATAGGAGAGGG + Intergenic
1090567605 11:128012382-128012404 TTGAATGTACATATACACAATGG + Intergenic
1091076357 11:132621415-132621437 GAGAATGAACAAATAGATTATGG + Intronic
1092869037 12:12789044-12789066 GAGAAGGTAATAATAGACAAAGG - Exonic
1093419466 12:18958209-18958231 GAAAATGTACACATACACAATGG - Intergenic
1093476487 12:19560766-19560788 GTTAATGGAAAAATGGACAATGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093689076 12:22089144-22089166 GAGAATGTACAAATAGACTTGGG - Intronic
1094754071 12:33445863-33445885 GTGAATGGAGAAATAGATAAAGG - Intergenic
1095484112 12:42666471-42666493 GTGAATGGATAAATAGCCATTGG - Intergenic
1095543432 12:43338331-43338353 GTGAAAGTGCAACGAGACAACGG + Intergenic
1095615470 12:44183233-44183255 GGGAATGTCTAAATAAACAATGG - Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1097619094 12:61918517-61918539 GAAAATGTACACATACACAATGG - Intronic
1098079306 12:66766918-66766940 GAGAATGAACAAATGGATAAGGG + Intronic
1098753798 12:74331332-74331354 ATGAAAGCAAAAATAGACAAGGG + Intergenic
1099092955 12:78337060-78337082 GGAAATGTACATATACACAATGG + Intergenic
1099480782 12:83163206-83163228 GTAAATGTGGAAATAGAAAAAGG - Intergenic
1101502147 12:105314215-105314237 GGGAGTGTACAAATAGGGAATGG - Intronic
1102422200 12:112812728-112812750 GTGAATGAATAAATATACAAAGG - Intronic
1102735681 12:115157254-115157276 GTGAATGGACAAATAAAAGAGGG - Intergenic
1103438936 12:120948704-120948726 GTGAATGGACAAATAGAATATGG - Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1105459958 13:20575316-20575338 GAAAATGTACATATATACAATGG - Intronic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106575344 13:30969363-30969385 GTGACTGTACAAACACCCAAAGG - Intronic
1106866309 13:33967994-33968016 GTGAATTTACAGAAAGACAAAGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107387208 13:39924978-39925000 AAGAATATACAAATATACAAGGG - Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1107915861 13:45149953-45149975 GAGAATGAACAACTAGAAAAGGG - Intronic
1108020123 13:46119860-46119882 TTGTATGTACAAATAGAGAATGG + Intergenic
1109224630 13:59677845-59677867 GTGAATGGCAAAATAGACAAAGG + Intronic
1109405161 13:61888139-61888161 GAAAATATACAATTAGACAATGG + Intergenic
1109638531 13:65154869-65154891 GTCAATTCACAAAGAGACAAAGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1110457063 13:75700995-75701017 ATGAATGAACAAATAGAACATGG - Intronic
1110956957 13:81564853-81564875 GTGAATGGATAAATAAACCATGG - Intergenic
1111199711 13:84918226-84918248 TGAAAAGTACAAATAGACAAAGG + Intergenic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1113003204 13:105667744-105667766 GTGAATGAACAAATAAACCATGG + Intergenic
1113271287 13:108677508-108677530 GTGCATGTATAAATACACACAGG - Intronic
1114282061 14:21202270-21202292 TTGAATGAATAAATAGAAAAGGG - Intergenic
1115029102 14:28773915-28773937 GTTAGTGTGCAAATAGAGAAGGG - Intronic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115173668 14:30537308-30537330 TTCAATTTAAAAATAGACAAGGG - Intergenic
1115205178 14:30895916-30895938 GTGAATGTTCTAAAAGACACAGG - Intronic
1115211632 14:30972423-30972445 GTGAACGTACACTTGGACAAGGG - Intronic
1115751818 14:36501388-36501410 ATAAATGTATAAAAAGACAAGGG + Intronic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116367007 14:44079214-44079236 GTGAAACTAGAAAGAGACAAAGG - Intergenic
1116440233 14:44942676-44942698 AGGAATGTACAAAGACACAATGG - Intronic
1116526208 14:45908902-45908924 GTGCATTTAAAAATAGAAAATGG + Intergenic
1116648259 14:47557847-47557869 TTGAATGTACAAATTAATAAAGG - Intronic
1117082826 14:52168602-52168624 GTTAATGAACAATTAGAAAAAGG + Intergenic
1117732767 14:58740507-58740529 GTGAAAGAAGAAATAAACAAGGG + Intergenic
1117994261 14:61463943-61463965 ATGAATGGACAAAGAAACAACGG - Intronic
1118146937 14:63147899-63147921 GTAAATGTACATATACACCATGG - Intergenic
1118335136 14:64847066-64847088 GTGGAGCTACACATAGACAAGGG - Intronic
1119451603 14:74716636-74716658 GGGGATATACAAATACACAAGGG - Intronic
1119946027 14:78695370-78695392 TTGAATCTACAAAAAGAGAAAGG - Intronic
1119978988 14:79058390-79058412 GTAAGTGGAGAAATAGACAATGG + Intronic
1122029899 14:98904721-98904743 GTGGATGGATAAATAGACAGTGG - Intergenic
1122497359 14:102167889-102167911 ATGAATGGATAAATATACAAGGG + Intronic
1122727994 14:103772216-103772238 ATAAATGCACAAATAGACTATGG - Intronic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1124474967 15:30025386-30025408 GGAAATATACAAATATACAAGGG - Intergenic
1125006787 15:34825471-34825493 TTGAATATACAAATAAAAAATGG + Intergenic
1125166948 15:36717542-36717564 GTGAATGGATAAATAAACAGTGG - Intronic
1125278166 15:38015669-38015691 GTAAATGTATAAATAAACTATGG + Intergenic
1126511262 15:49477486-49477508 GTGAAGCCACAAAAAGACAAGGG - Intronic
1126668826 15:51097550-51097572 TTGAATGTGGAATTAGACAATGG + Intronic
1126872117 15:53001145-53001167 GTGAATGTACTAATAGCAAGAGG + Intergenic
1127174059 15:56335279-56335301 GAAAATGTACATATACACAATGG + Intronic
1127390671 15:58502745-58502767 GAGAATGTACAAAATGAGAAAGG + Intronic
1127858527 15:62973263-62973285 GTGTAAGTACAAACAGCCAAGGG + Intergenic
1128057177 15:64708879-64708901 AAAAATGTACATATAGACAACGG - Intergenic
1129593976 15:76944739-76944761 GAAAATGTACATATACACAATGG - Intronic
1129958082 15:79657577-79657599 CTGTATATACAAACAGACAATGG + Intergenic
1131315304 15:91330465-91330487 GGGAACTTACAAATAGGCAAGGG - Intergenic
1131912284 15:97221090-97221112 GTGAATGAAGAAATGAACAATGG - Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1132365947 15:101256929-101256951 GGGAATGGATAAATACACAAAGG + Intergenic
1132401838 15:101514235-101514257 GTGAATGGACAAATAAACTGTGG - Intronic
1133617225 16:7488842-7488864 ATGAATGTATAGATAGATAATGG - Intronic
1135055240 16:19226617-19226639 ATGGAGTTACAAATAGACAAGGG + Intronic
1135219131 16:20598263-20598285 GAAAATGTACATATACACAATGG + Intergenic
1138119123 16:54384090-54384112 GTGAATGGACCAATAGGCCAGGG + Intergenic
1138685928 16:58725570-58725592 GAGCATGTAAAAATAAACAAAGG - Intronic
1139172195 16:64645695-64645717 GTCAAGGTACCACTAGACAAAGG - Intergenic
1140223583 16:73061467-73061489 CTGAAGGTAAAAATATACAATGG - Intergenic
1140572179 16:76120352-76120374 CTGAATGGACAAATAGAATAAGG + Intergenic
1141854770 16:86673574-86673596 GTGAATGGACAAATGGATCAAGG - Intergenic
1142928833 17:3265223-3265245 GATATTGTACAACTAGACAAAGG - Intergenic
1143308655 17:5970136-5970158 GAGAATGGACTAATAGACATAGG + Intronic
1143742154 17:8962311-8962333 ATGAATGTACAAAAAGACACAGG + Intronic
1144221375 17:13102826-13102848 CTGAATGTACCCATGGACAATGG - Intergenic
1147226460 17:38982085-38982107 GTGAATGGACAAATAAACTGTGG + Intergenic
1148392494 17:47282848-47282870 GAAAGTGTACAAATAGTCAAAGG - Intronic
1149288460 17:55192163-55192185 GTGAATTGATAAAAAGACAAAGG + Intergenic
1150536221 17:66044956-66044978 CTCAATTTAAAAATAGACAAAGG + Intronic
1152806291 17:82357951-82357973 GTGAATGGATAAATAAACCATGG + Intergenic
1154407937 18:14113081-14113103 GCCAATGTACATATACACAAAGG - Intronic
1154488189 18:14895706-14895728 GTGAAGCCACAAAAAGACAAGGG + Intergenic
1154928346 18:20963653-20963675 GAGAATGTAGAAATAGATGATGG - Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1156248594 18:35328661-35328683 GTGAATGGATAAATAAACTATGG - Intergenic
1156283381 18:35664436-35664458 ATCAATGTATAAATAAACAATGG - Intronic
1156993372 18:43437465-43437487 GAAAATGTACATATATACAATGG - Intergenic
1157015255 18:43704406-43704428 TTGAATATACGAACAGACAATGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157503836 18:48211955-48211977 GTGAATGGATAAATAAACCATGG + Intronic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159812017 18:73027188-73027210 GTGAATGGACTAATACAAAATGG + Intergenic
1160106381 18:75982263-75982285 GTAAATGTCAAAATTGACAATGG - Intergenic
1160496378 18:79378411-79378433 GTGATTTTGCAAATAGAAAAAGG - Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1160613057 18:80104043-80104065 CTGAATGTGCCAACAGACAATGG + Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1162117097 19:8437324-8437346 GTGAATGAATAAATAAACAGTGG - Intronic
1163083493 19:14961479-14961501 GTGAATGAACAGATAAGCAAGGG + Intronic
1163573198 19:18095311-18095333 GTACATGTACATATATACAATGG + Intronic
1166020619 19:40025291-40025313 GTTAATGAACAAACAGGCAATGG - Intergenic
1166576043 19:43838877-43838899 CTGATTGTAAAACTAGACAAGGG - Intronic
1167284683 19:48592494-48592516 CTGGATGGACAGATAGACAAAGG + Intronic
1167879992 19:52449213-52449235 GAAAATGTATATATAGACAATGG - Intronic
925074594 2:1004951-1004973 GTGAATGGAGAAATAAACTATGG + Intronic
925363894 2:3297958-3297980 GTGAATGAGCAAATGAACAAAGG - Intronic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
926221127 2:10936162-10936184 GTGAATGCACAAAGAAACAAGGG + Intergenic
927073061 2:19549568-19549590 GGGAATGTACAAGTTGGCAAGGG + Intergenic
927223761 2:20740657-20740679 GTGAATGAATAAATACACTACGG - Intronic
927283353 2:21331086-21331108 CTGATTTTACAAATAGAGAATGG + Intergenic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
928505405 2:31946885-31946907 GTGTATGTAAACATAGAAAAGGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929364225 2:41132784-41132806 GCTAATGTGAAAATAGACAATGG + Intergenic
930482798 2:51970512-51970534 GTGAATAGACAAATACATAATGG + Intergenic
932058746 2:68473377-68473399 GTGAATGGATAAACCGACAATGG - Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933932274 2:87165561-87165583 GTGAATGCACAAAGAGGGAAGGG - Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935330148 2:101971219-101971241 GTGGATATACAAAAAGACAATGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
936275069 2:111088879-111088901 GTTTATGTACAAATAGAAAAGGG + Intronic
936360839 2:111799874-111799896 GTGAATGCACAAAGAGGGAAGGG + Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
938772134 2:134509732-134509754 GTGAATGTGAAAATAGGCAATGG + Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
938979460 2:136512345-136512367 ATCAATGGACAAATAGACACTGG - Intergenic
939164499 2:138626102-138626124 GTGAATGTAAGAATGGAGAAGGG - Intergenic
939204771 2:139086778-139086800 GAAGATGTACAAATAGCCAATGG - Intergenic
941832771 2:169980528-169980550 ATGAACGAACAAATAAACAAGGG - Intronic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
941949813 2:171143111-171143133 ATGAATGCACGAATGGACAAAGG + Intronic
942287676 2:174437122-174437144 AAGTATGTACAAATAAACAAAGG + Intronic
943194682 2:184730750-184730772 GTGAATAGACAAATAAACCATGG - Intronic
943453830 2:188078172-188078194 GACAATGTACAAATAGAAAAGGG + Intergenic
943926436 2:193788505-193788527 GTGAATCAACAAATAAACAGTGG + Intergenic
943929282 2:193829140-193829162 GTGTATGTAAACATAGAAAAGGG + Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945691902 2:213046865-213046887 GCCAATGTACAAAGTGACAATGG + Intronic
946042269 2:216792480-216792502 CTGAATGAATTAATAGACAAAGG + Intergenic
1168823340 20:792164-792186 GTGAGTGTACACCTGGACAAGGG - Intergenic
1169536873 20:6554042-6554064 GTGAATGGATAAATAAACTATGG - Intergenic
1170359010 20:15524066-15524088 ATGAATGTGCACACAGACAAAGG - Intronic
1170406498 20:16043432-16043454 ATCAGTATACAAATAGACAATGG - Intronic
1173175410 20:40761202-40761224 GTGAATGGATAAATAGACTATGG - Intergenic
1173630328 20:44508802-44508824 GTGAATGCATAAATACATAAAGG + Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1173965672 20:47110717-47110739 TTGAATAAACAAATAAACAAAGG + Intronic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176793085 21:13343627-13343649 GTGAAGCCACAAAAAGACAAGGG - Intergenic
1177556094 21:22690543-22690565 GTGGATATAGAAACAGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178055548 21:28794592-28794614 GGAAATGTACAAATAATCAAAGG + Intergenic
1178340533 21:31782301-31782323 GTGAATGAAGAAAGAGAGAATGG - Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179018209 21:37613532-37613554 GTGAATGGATAAATAAACAGTGG + Exonic
1179074894 21:38111707-38111729 GTGACTGGACAAATAAACTATGG - Intronic
1179623705 21:42635164-42635186 GTGGATGAACAGATGGACAATGG - Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180207188 21:46268217-46268239 ATAAAAGTAAAAATAGACAAAGG + Intronic
1181367731 22:22391618-22391640 GTGAAGGAGAAAATAGACAATGG + Intergenic
1181476573 22:23171520-23171542 GTGTATGTACATGTATACAATGG - Intergenic
1182957936 22:34444887-34444909 GTGAATGCGCGAAAAGACAAAGG + Intergenic
1183801419 22:40168234-40168256 ATGAATGAACAAATAAGCAAAGG - Intronic
949686771 3:6582801-6582823 GTGAATGGATAAACAGACTATGG + Intergenic
949792479 3:7808425-7808447 GTGAATTTACAAATAGATGCAGG + Intergenic
949983007 3:9514878-9514900 GTGAATGTATAAATAAACTATGG - Intronic
950685025 3:14610706-14610728 GTGAATGGACAAACAAACTATGG - Intergenic
951096502 3:18638055-18638077 GAAAATGTACATATACACAATGG + Intergenic
951380242 3:21975193-21975215 GAAAATGTACATATACACAATGG + Intronic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
954937530 3:54340607-54340629 GTGAATGGATAAATAAACTATGG - Intronic
955607287 3:60719366-60719388 GAGAATGTGCAAACAGACAGAGG - Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956063139 3:65369068-65369090 ATGAATGAATAAATACACAATGG - Intronic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
956809519 3:72850855-72850877 ATGGATGTAGAAATAGAAAAGGG - Intronic
957126499 3:76168064-76168086 GGCAATATAAAAATAGACAAAGG - Intronic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
957468334 3:80624748-80624770 GTGAATGGAAAATTAGATAATGG + Intergenic
957743809 3:84311256-84311278 GTCAATGTAGAAAAATACAATGG - Intergenic
959178872 3:102953510-102953532 GACAATATACAAATGGACAATGG + Intergenic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
960160766 3:114348465-114348487 GTGAATGTACTAATAACCAGAGG - Intronic
960841980 3:121968410-121968432 GTGAATGTATAAACAAACTATGG - Intergenic
962418539 3:135206231-135206253 GTGAATGGACAAATAAACCATGG - Intronic
963006909 3:140734927-140734949 GAGAATGGACTAATATACAAGGG + Intergenic
963026146 3:140921236-140921258 GTGAATGGATAAATAAACTATGG - Intergenic
963396946 3:144747110-144747132 CTTATTGTACAAATGGACAATGG + Intergenic
963858676 3:150283666-150283688 GAAAATGTACATATACACAATGG + Intergenic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966290454 3:178350329-178350351 GTGAATGTAAAAAAATACACAGG + Intergenic
966648848 3:182276370-182276392 GTTCATGTACAAATTGCCAAAGG - Intergenic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
967808975 3:193739513-193739535 GTGAATGGACAAATAAACGGTGG - Intergenic
968200367 3:196748689-196748711 GTGAATGTACATCCAGACAATGG - Intronic
969374941 4:6756707-6756729 GTCAACGTATAAATATACAAGGG - Intergenic
969627662 4:8315945-8315967 GTGAATGTGAAAATACACAAAGG - Intergenic
969837104 4:9850884-9850906 ATGAATGCACAAATGGACACTGG + Intronic
970063632 4:12065469-12065491 GTGCATGTATAAATATACACAGG - Intergenic
970070249 4:12150160-12150182 GTACATGTACACATACACAATGG - Intergenic
970100108 4:12511784-12511806 GTGAATGGATAAATAGACTATGG - Intergenic
970505488 4:16725319-16725341 TTGAATATGCCAATAGACAATGG + Intronic
970615189 4:17762197-17762219 GTAAATGAACAAATTAACAAAGG + Intronic
970643020 4:18088633-18088655 GAGAATGGAATAATAGACAATGG - Intergenic
970808044 4:20059084-20059106 GTGAGTATATAAATACACAATGG - Intergenic
970982405 4:22115416-22115438 GTGATTCTAAAAATAAACAAAGG - Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971745295 4:30572196-30572218 GAGAATATACAAACAGACACTGG + Intergenic
972925490 4:44001067-44001089 GGGAATGTAGCAATAAACAATGG + Intergenic
973263720 4:48189507-48189529 GAAAATGCAGAAATAGACAATGG + Intronic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
974734021 4:65905309-65905331 ATGAAAGAACATATAGACAAAGG + Intergenic
974784892 4:66607516-66607538 GTGAATTTTCAGATAGAGAAAGG + Intergenic
975044880 4:69790072-69790094 GTGAATATAAAAATAAAAAAAGG - Intergenic
975204916 4:71634501-71634523 GTGAGTGTACACTTGGACAACGG + Intergenic
975213322 4:71726171-71726193 AGGAATTTACAAATAAACAAGGG - Intergenic
975482801 4:74900533-74900555 GTTTATGTGCAAATAGACAAAGG + Intergenic
975585615 4:75945235-75945257 GTGGATGTATGAATAAACAATGG + Intronic
976557200 4:86463039-86463061 GTTAATGAACAATTAGAAAAAGG + Intronic
976994006 4:91406898-91406920 GAGAATATTCAAATAAACAAAGG - Intronic
978038100 4:104021791-104021813 TTGAATATATAAACAGACAATGG + Intergenic
978278490 4:106980305-106980327 GTGTATGTACATATATACACAGG + Intronic
978524145 4:109647559-109647581 ATGAATGAATAAATAAACAATGG - Intronic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
979158089 4:117423531-117423553 GAAAATGTACATATACACAATGG - Intergenic
979427981 4:120591614-120591636 GTGAATGAACAAATGGATACAGG + Intergenic
980654250 4:135761466-135761488 GTGAATTTACAAAGATAAAAAGG - Intergenic
982173460 4:152683404-152683426 CTGGATGTACAAATGGACAGTGG - Intergenic
982429207 4:155303261-155303283 GTGAATGAAAAAATAAACTATGG + Intergenic
982491311 4:156032959-156032981 GTGAATGTATAAATAAACTGTGG - Intergenic
982967293 4:161928283-161928305 GTGAATGGATAAATAAACCATGG - Intronic
983128477 4:163984294-163984316 GAAAATGTACATATAAACAAAGG + Intronic
983507277 4:168567765-168567787 GTGAATGGAATAATATACAATGG + Intronic
984357959 4:178689554-178689576 GTGAATATAGAAATACAAAAAGG + Intergenic
985500987 5:245119-245141 GTTAATGAACAATTAGAAAAGGG + Intronic
985735874 5:1582407-1582429 GTTAATGAACAATTAGAAAAGGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986904385 5:12476220-12476242 TTGAATATAGAAGTAGACAATGG - Intergenic
987315932 5:16723729-16723751 GTGAATGGACAAAGAAACTACGG + Intronic
987361472 5:17111214-17111236 GTGAATGTTCAAATACACAGTGG + Intronic
987437782 5:17917962-17917984 GTCAATATTCAAATAGAAAATGG + Intergenic
987622931 5:20359237-20359259 GTAAATGTACATACAGAAAAGGG - Intronic
987964477 5:24853948-24853970 TTGAATGGACAAATGGACCAGGG - Intergenic
988398675 5:30732119-30732141 TTGAAAGAACAAATAAACAATGG + Intergenic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
990152614 5:52836625-52836647 GAGAAGGCACAAGTAGACAAAGG - Intronic
990498345 5:56370640-56370662 GAGAAAGAACAAATACACAAGGG + Intergenic
990598669 5:57335770-57335792 GTGAATTTACAGAGAAACAAAGG + Intergenic
990627396 5:57630118-57630140 GAGAATATACAAATGGATAATGG + Intergenic
991531166 5:67616376-67616398 GTGAATGAATAAACAGACTATGG + Intergenic
992303766 5:75412686-75412708 GTGAATCTAAACATAGAAAAGGG + Intronic
993299559 5:86190793-86190815 TTGCATCTACAAATAGGCAAAGG + Intergenic
993480266 5:88415703-88415725 GTCAATGGAAATATAGACAAAGG + Intergenic
993605451 5:89985344-89985366 GTCAAAATACAAATAGTCAAAGG + Intergenic
994076147 5:95651959-95651981 GTGAACTTACAAAGAGAAAAGGG + Intronic
994976207 5:106810447-106810469 GTGAATGGACAAATAAACTGTGG - Intergenic
995128973 5:108609725-108609747 GTGAGTGCACATTTAGACAAAGG + Intergenic
995638021 5:114218354-114218376 GTGAATGGATAAATAAACTATGG + Intergenic
996306789 5:122056103-122056125 GAGAATGGACAAAAAGAAAACGG - Intronic
996473764 5:123891075-123891097 GTGAATGAATAAATTGAGAAGGG + Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997263594 5:132482027-132482049 GTTTATGTTCACATAGACAATGG - Exonic
999858832 5:155623669-155623691 GGGAATGCACAAATGGACAGAGG - Intergenic
1000224221 5:159243639-159243661 GTGAATGTACTAAAAGCCACTGG - Intergenic
1000459480 5:161496982-161497004 GTGAATGGAAAAATACCCAAAGG - Intronic
1000471145 5:161643639-161643661 GTAAATGTAAAAATAGAAATAGG - Intronic
1003237283 6:4307017-4307039 GTGAATGGACAAATAAACTCTGG - Intergenic
1003673677 6:8182797-8182819 CTGAAAATACAAATAGACAGAGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1007028970 6:38609512-38609534 GTGTATGTACACATAGAAGAAGG - Intronic
1007362076 6:41365915-41365937 GAAAATGTACATATACACAATGG - Intergenic
1007796794 6:44355378-44355400 GTGAATGAATAAATAAACTATGG - Intronic
1007830619 6:44635625-44635647 GTGAATGGATAAATAAACTATGG - Intergenic
1008013734 6:46494354-46494376 GTGAATGAACAAATAAACTGTGG - Intergenic
1008168657 6:48173863-48173885 GTGAATATACAAATTTCCAAAGG + Intergenic
1008281110 6:49597349-49597371 GTGAATAAACAAAAAGAAAAAGG + Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009931087 6:70178524-70178546 AAGAATCTAGAAATAGACAATGG + Intronic
1011114161 6:83872175-83872197 CTGAATGTGCAAAAAGATAATGG - Intronic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1012096027 6:94962426-94962448 GTCATTGAACAAATACACAACGG - Intergenic
1012339838 6:98106387-98106409 ATGATTGTACAAGTAGAAAATGG + Intergenic
1012850388 6:104439736-104439758 GTGAAGGTCCACAAAGACAATGG + Intergenic
1013154305 6:107478292-107478314 GTGAAAGTACAAACAGTTAAGGG + Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013519443 6:110919052-110919074 GTTAATGAACAATTAGAAAAAGG + Intergenic
1013687790 6:112605621-112605643 GACAATGTACATATACACAATGG + Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1015087154 6:129309404-129309426 TTGACAGTACAAATAGACATTGG - Intronic
1016222604 6:141693412-141693434 GTGAATGTATAAATAAACTGTGG + Intergenic
1016549316 6:145259083-145259105 GTATATGAACAATTAGACAAAGG - Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016651929 6:146471818-146471840 GGAAATATTCAAATAGACAAAGG + Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017558572 6:155601857-155601879 GTGAATGAATAAATTAACAAAGG + Intergenic
1017869103 6:158471126-158471148 GAGATTGTAGAAAGAGACAAAGG + Intronic
1017966103 6:159267847-159267869 GTGAATCCACAAATTGGCAATGG - Exonic
1018078752 6:160240292-160240314 GTGAATGTTTAAAGAGAAAATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018345794 6:162898003-162898025 GTGAATGTAGACATGGACAGGGG - Intronic
1020696095 7:11415580-11415602 GTGAATGTTCGAAGAGAAAAAGG - Intronic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1021019960 7:15585299-15585321 GAGAATGGACAAATACAAAAGGG + Intergenic
1021792659 7:24221590-24221612 AAGGATATACAAATAGACAATGG + Intergenic
1022075325 7:26963188-26963210 GTGAATGGATAAATAAACGAAGG + Intronic
1022891512 7:34704980-34705002 GAGACTGAACATATAGACAATGG - Intronic
1023308386 7:38855622-38855644 TTGAATGTACAAGGAGATAAGGG + Intronic
1023421058 7:39980247-39980269 GTGAAATTAAAAATAGAGAATGG + Intronic
1023799768 7:43823754-43823776 GTGAATGCACACCTGGACAAGGG - Intergenic
1023896446 7:44437380-44437402 GAGAATTTACAAAGAAACAAAGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1026213676 7:68329233-68329255 GTGAATGTCCAGAGAGAAAAAGG - Intergenic
1026981267 7:74528128-74528150 GTGAATATACAAATGGCTAAAGG - Intronic
1027215631 7:76181720-76181742 ATGAATCAACAAATAGAAAAAGG + Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1030463124 7:109865810-109865832 CTCAGTGTACAAATAGAAAAAGG + Intergenic
1030643211 7:112029199-112029221 GTGAATGTGCAAGTACAGAAAGG + Intronic
1030905507 7:115176292-115176314 GTGAATGGATAAATAGGCCATGG + Intergenic
1031164887 7:118216072-118216094 GTGAATGTACAAATAGACAATGG + Intronic
1032112625 7:129089665-129089687 ATGAAAATACAAACAGACAATGG + Intergenic
1033117891 7:138641869-138641891 GTGTATGTATATATAGTCAATGG + Intronic
1033835641 7:145307939-145307961 ATAAAAGCACAAATAGACAAGGG + Intergenic
1034016434 7:147592205-147592227 GTGAATGAATAAATATATAAAGG + Intronic
1034403078 7:150878910-150878932 GTGAAACTACTAAAAGACAAAGG + Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035843707 8:2840682-2840704 GTGACTGTTAAAAAAGACAAGGG + Intergenic
1036000857 8:4602045-4602067 ATGAATATAGAAATAGATAAAGG + Intronic
1037475787 8:19256489-19256511 GTGAATGGATAAATACACATTGG + Intergenic
1037672298 8:21025546-21025568 GACAATGAACAAATAAACAAAGG + Intergenic
1037747597 8:21659317-21659339 ATGAATGAATAAATAGATAAAGG - Intergenic
1038272017 8:26082901-26082923 ATGAATGGATAAATAGACTAAGG - Intergenic
1038442080 8:27577874-27577896 GAGTATGTACAAATACACCATGG - Intergenic
1038549794 8:28457375-28457397 GAAAATGGACAAATACACAAGGG - Intronic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039006106 8:33038850-33038872 GTGAATGCACACCTGGACAAGGG - Intergenic
1039321123 8:36432869-36432891 GTGAATGAACAAATAAACTGTGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1039953250 8:42188452-42188474 GTGAAGGTACAAGCAGAAAAGGG - Intronic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041296765 8:56364778-56364800 GAGAATGTATATATACACAATGG + Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043868850 8:85406815-85406837 GTGAATATACTAAAAGACACTGG + Intronic
1043945441 8:86246168-86246190 GAAAATGTACATATACACAAGGG - Intronic
1044104229 8:88182822-88182844 GTGAATGAATAAATATACAATGG + Intronic
1044203500 8:89464088-89464110 GACAATATACAAATGGACAATGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045715785 8:105043353-105043375 TTAAATGTACAATTATACAATGG + Intronic
1046335279 8:112778558-112778580 GTGAATGGATAAATAAACTATGG - Intronic
1046422039 8:113999232-113999254 GTGTATGTGAAAATAGAAAATGG - Intergenic
1047661178 8:127038652-127038674 GTGAATGAACAAAGAGAAAAGGG - Intergenic
1047805493 8:128355312-128355334 GTGGAGGGAGAAATAGACAAAGG - Intergenic
1049913177 9:290103-290125 GTTAATGGATAAATAAACAATGG - Intronic
1050404187 9:5290558-5290580 GTGAATGAATAAATAGACTGTGG + Intergenic
1050411117 9:5366226-5366248 ATGAATGTACACATAGTTAAAGG - Intronic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051192846 9:14533517-14533539 GTGAATATAAAAATACCCAAAGG - Intergenic
1051753289 9:20367094-20367116 GAGAATTTACAAAAAAACAATGG - Intronic
1051910126 9:22144768-22144790 GGGAGTGTACAGATAAACAAGGG - Intergenic
1052162359 9:25280498-25280520 GTGAATGTACAAATAAATCATGG + Intergenic
1052782109 9:32792088-32792110 ACGAATGCAAAAATAGACAATGG + Intergenic
1053111272 9:35461732-35461754 GTGAATGCACACTTGGACAAGGG + Intergenic
1053297003 9:36922386-36922408 GGTACTGCACAAATAGACAAGGG - Intronic
1053621542 9:39824545-39824567 GTGAAGCCACAAAAAGACAAGGG + Intergenic
1053883554 9:42619760-42619782 GTGAAGCCACAAAAAGACAAGGG - Intergenic
1053889115 9:42674538-42674560 GTGAAGCCACAAAAAGACAAGGG + Intergenic
1054222574 9:62427224-62427246 GTGAAGCCACAAAAAGACAAGGG - Intergenic
1054228136 9:62481951-62481973 GTGAAGCCACAAAAAGACAAGGG + Intergenic
1055214879 9:73847169-73847191 GTGAATGAATAAATAAACAAAGG - Intergenic
1055387619 9:75780282-75780304 GAAAATGTACATATACACAATGG + Intergenic
1056100997 9:83300798-83300820 GTGAATGTACAGATGTACGAAGG + Intronic
1056288709 9:85118726-85118748 TTGCAGGGACAAATAGACAAGGG + Intergenic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1057644700 9:96862040-96862062 GAAAATGTACATATACACAATGG + Intronic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1057862753 9:98654863-98654885 GTGAATGGATAAATAAACCATGG + Intronic
1058417088 9:104800613-104800635 GTGACTGTTCACATAGATAAGGG + Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059544907 9:115166628-115166650 GAGAATGTACAAAGAACCAAAGG - Intronic
1059636379 9:116175096-116175118 TTGAATGTATAAATAGTGAAAGG - Intronic
1060097172 9:120801803-120801825 GTTAATATCCAAATAGATAAGGG - Intergenic
1060848181 9:126853744-126853766 GTGAATATAGAAGTAGACACGGG - Intergenic
1185702575 X:2242361-2242383 GAGAATGTACAAATACATCACGG + Intronic
1187777429 X:22777848-22777870 ATAAATGTACAAATAAAAAATGG - Intergenic
1188287263 X:28343012-28343034 GAAAATGTACATATACACAACGG - Intergenic
1188344163 X:29043748-29043770 GTGAATGTAAAGATACCCAATGG + Intronic
1189079608 X:37957163-37957185 GCGAATATACAAATATATAAAGG - Intronic
1189361178 X:40353221-40353243 CTGATAGTACAAACAGACAAAGG + Intergenic
1189612281 X:42750138-42750160 GTAAATGTACTTATACACAATGG + Intergenic
1190139419 X:47829267-47829289 CTGAATATACAAACAGGCAATGG - Intergenic
1190748289 X:53339857-53339879 CTGAACGTACAAATTGACAATGG + Intergenic
1190775679 X:53550640-53550662 GGTAAGGTAAAAATAGACAAAGG + Intronic
1191213543 X:57912748-57912770 GTGAATATACAAACAGAGCAAGG - Intergenic
1192688896 X:73338294-73338316 GAAAATGTACATATACACAATGG + Intergenic
1192975568 X:76280498-76280520 GAAAATGTACATATACACAACGG - Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193413271 X:81190917-81190939 GTGAAAGAACAAATAGATCAAGG - Intronic
1194202346 X:90968931-90968953 ATGCATGCACAAATATACAAAGG + Intergenic
1194391293 X:93321096-93321118 GAAAATGTACATATACACAATGG - Intergenic
1194606369 X:95983901-95983923 GAAAAAGTACAAATAGACTAAGG - Intergenic
1194812123 X:98399651-98399673 AGGAGAGTACAAATAGACAATGG + Intergenic
1195350557 X:103992114-103992136 GTAAATGGAGAAATCGACAAAGG - Intergenic
1195496083 X:105535561-105535583 GTGAATGGATAAATAAACCATGG + Intronic
1196357133 X:114808328-114808350 GAAAATGTACACATACACAATGG - Intronic
1197183191 X:123559194-123559216 GTGAATGCAGAAACAGATAAGGG + Intergenic
1197831128 X:130644505-130644527 GTGAATGGATAAATAAACTATGG + Intronic
1199084598 X:143614311-143614333 GTGTATATATAAATAGATAAAGG + Intergenic
1199099146 X:143778745-143778767 GAAAATGTACATATACACAATGG + Intergenic
1199204143 X:145128089-145128111 TCGAATATACAAACAGACAACGG + Intergenic
1200548183 Y:4544386-4544408 ATGCATGCACAAATATACAAAGG + Intergenic
1200723471 Y:6634559-6634581 ATGAATTAATAAATAGACAAGGG + Intergenic
1200781615 Y:7221384-7221406 GTGGATGTATAAATATATAATGG + Intergenic
1201265788 Y:12205324-12205346 GTAAATGTTTACATAGACAATGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic