ID: 1031170471

View in Genome Browser
Species Human (GRCh38)
Location 7:118286463-118286485
Sequence CAGAGTACTGAGGCTGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031170471_1031170478 0 Left 1031170471 7:118286463-118286485 CCCCACTCAGCCTCAGTACTCTG No data
Right 1031170478 7:118286486-118286508 CTTGTCCTCACTAGGCTGGGAGG No data
1031170471_1031170475 -8 Left 1031170471 7:118286463-118286485 CCCCACTCAGCCTCAGTACTCTG No data
Right 1031170475 7:118286478-118286500 GTACTCTGCTTGTCCTCACTAGG No data
1031170471_1031170476 -4 Left 1031170471 7:118286463-118286485 CCCCACTCAGCCTCAGTACTCTG No data
Right 1031170476 7:118286482-118286504 TCTGCTTGTCCTCACTAGGCTGG No data
1031170471_1031170477 -3 Left 1031170471 7:118286463-118286485 CCCCACTCAGCCTCAGTACTCTG No data
Right 1031170477 7:118286483-118286505 CTGCTTGTCCTCACTAGGCTGGG No data
1031170471_1031170481 27 Left 1031170471 7:118286463-118286485 CCCCACTCAGCCTCAGTACTCTG No data
Right 1031170481 7:118286513-118286535 CCCATTTTAATAAATAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031170471 Original CRISPR CAGAGTACTGAGGCTGAGTG GGG (reversed) Intergenic
No off target data available for this crispr