ID: 1031170476

View in Genome Browser
Species Human (GRCh38)
Location 7:118286482-118286504
Sequence TCTGCTTGTCCTCACTAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031170472_1031170476 -5 Left 1031170472 7:118286464-118286486 CCCACTCAGCCTCAGTACTCTGC No data
Right 1031170476 7:118286482-118286504 TCTGCTTGTCCTCACTAGGCTGG No data
1031170473_1031170476 -6 Left 1031170473 7:118286465-118286487 CCACTCAGCCTCAGTACTCTGCT No data
Right 1031170476 7:118286482-118286504 TCTGCTTGTCCTCACTAGGCTGG No data
1031170468_1031170476 21 Left 1031170468 7:118286438-118286460 CCCAATTCAAGTGGCCAAGCAGT No data
Right 1031170476 7:118286482-118286504 TCTGCTTGTCCTCACTAGGCTGG No data
1031170469_1031170476 20 Left 1031170469 7:118286439-118286461 CCAATTCAAGTGGCCAAGCAGTG No data
Right 1031170476 7:118286482-118286504 TCTGCTTGTCCTCACTAGGCTGG No data
1031170470_1031170476 7 Left 1031170470 7:118286452-118286474 CCAAGCAGTGACCCCACTCAGCC No data
Right 1031170476 7:118286482-118286504 TCTGCTTGTCCTCACTAGGCTGG No data
1031170471_1031170476 -4 Left 1031170471 7:118286463-118286485 CCCCACTCAGCCTCAGTACTCTG No data
Right 1031170476 7:118286482-118286504 TCTGCTTGTCCTCACTAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031170476 Original CRISPR TCTGCTTGTCCTCACTAGGC TGG Intergenic
No off target data available for this crispr