ID: 1031173918

View in Genome Browser
Species Human (GRCh38)
Location 7:118325066-118325088
Sequence CCATGCCAGCAGAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031173908_1031173918 11 Left 1031173908 7:118325032-118325054 CCATCACTGCTTCCTGTTACATG No data
Right 1031173918 7:118325066-118325088 CCATGCCAGCAGAGGGCAGAGGG No data
1031173906_1031173918 28 Left 1031173906 7:118325015-118325037 CCAGGGCTGGTCCAGTGCCATCA No data
Right 1031173918 7:118325066-118325088 CCATGCCAGCAGAGGGCAGAGGG No data
1031173911_1031173918 -1 Left 1031173911 7:118325044-118325066 CCTGTTACATGGGTCAGCTACCC No data
Right 1031173918 7:118325066-118325088 CCATGCCAGCAGAGGGCAGAGGG No data
1031173907_1031173918 17 Left 1031173907 7:118325026-118325048 CCAGTGCCATCACTGCTTCCTGT No data
Right 1031173918 7:118325066-118325088 CCATGCCAGCAGAGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031173918 Original CRISPR CCATGCCAGCAGAGGGCAGA GGG Intergenic
No off target data available for this crispr