ID: 1031173994

View in Genome Browser
Species Human (GRCh38)
Location 7:118325611-118325633
Sequence GGGACCTGCCCCATCTGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031173990_1031173994 4 Left 1031173990 7:118325584-118325606 CCTTGGTTTGAAGGTGTGGTTTC No data
Right 1031173994 7:118325611-118325633 GGGACCTGCCCCATCTGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031173994 Original CRISPR GGGACCTGCCCCATCTGCCT AGG Intergenic
No off target data available for this crispr