ID: 1031174763

View in Genome Browser
Species Human (GRCh38)
Location 7:118336471-118336493
Sequence TGAGTACCAGACTTGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031174763_1031174765 -4 Left 1031174763 7:118336471-118336493 CCTGGCTCCAAGTCTGGTACTCA No data
Right 1031174765 7:118336490-118336512 CTCATTGTTTTTTCTCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031174763 Original CRISPR TGAGTACCAGACTTGGAGCC AGG (reversed) Intergenic
No off target data available for this crispr