ID: 1031180106

View in Genome Browser
Species Human (GRCh38)
Location 7:118403199-118403221
Sequence CCATAGGTATGGATCTCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031180094_1031180106 11 Left 1031180094 7:118403165-118403187 CCATTTGACCAACCCTGCTTCCT No data
Right 1031180106 7:118403199-118403221 CCATAGGTATGGATCTCAAGGGG No data
1031180093_1031180106 30 Left 1031180093 7:118403146-118403168 CCTCATAGCACATAACTTACCAT No data
Right 1031180106 7:118403199-118403221 CCATAGGTATGGATCTCAAGGGG No data
1031180096_1031180106 -1 Left 1031180096 7:118403177-118403199 CCCTGCTTCCTTTCCCTCTCTTC No data
Right 1031180106 7:118403199-118403221 CCATAGGTATGGATCTCAAGGGG No data
1031180099_1031180106 -9 Left 1031180099 7:118403185-118403207 CCTTTCCCTCTCTTCCATAGGTA No data
Right 1031180106 7:118403199-118403221 CCATAGGTATGGATCTCAAGGGG No data
1031180097_1031180106 -2 Left 1031180097 7:118403178-118403200 CCTGCTTCCTTTCCCTCTCTTCC No data
Right 1031180106 7:118403199-118403221 CCATAGGTATGGATCTCAAGGGG No data
1031180095_1031180106 3 Left 1031180095 7:118403173-118403195 CCAACCCTGCTTCCTTTCCCTCT No data
Right 1031180106 7:118403199-118403221 CCATAGGTATGGATCTCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031180106 Original CRISPR CCATAGGTATGGATCTCAAG GGG Intergenic
No off target data available for this crispr