ID: 1031196053

View in Genome Browser
Species Human (GRCh38)
Location 7:118615328-118615350
Sequence CAGTGGAAGTAAAGAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031196048_1031196053 10 Left 1031196048 7:118615295-118615317 CCCAAAATAATAAAGACAGAATT No data
Right 1031196053 7:118615328-118615350 CAGTGGAAGTAAAGAGAAGAGGG No data
1031196049_1031196053 9 Left 1031196049 7:118615296-118615318 CCAAAATAATAAAGACAGAATTA No data
Right 1031196053 7:118615328-118615350 CAGTGGAAGTAAAGAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031196053 Original CRISPR CAGTGGAAGTAAAGAGAAGA GGG Intergenic
No off target data available for this crispr