ID: 1031215328

View in Genome Browser
Species Human (GRCh38)
Location 7:118883095-118883117
Sequence AGGGAGAGCACAGTGATCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031215319_1031215328 26 Left 1031215319 7:118883046-118883068 CCCAGCTGCGGCTGCATGGCGTT No data
Right 1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG No data
1031215320_1031215328 25 Left 1031215320 7:118883047-118883069 CCAGCTGCGGCTGCATGGCGTTG No data
Right 1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG No data
1031215318_1031215328 27 Left 1031215318 7:118883045-118883067 CCCCAGCTGCGGCTGCATGGCGT No data
Right 1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG No data
1031215317_1031215328 28 Left 1031215317 7:118883044-118883066 CCCCCAGCTGCGGCTGCATGGCG No data
Right 1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031215328 Original CRISPR AGGGAGAGCACAGTGATCGG GGG Intergenic
No off target data available for this crispr