ID: 1031224665

View in Genome Browser
Species Human (GRCh38)
Location 7:119020971-119020993
Sequence GAGAATCCTGCAGTCCTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031224659_1031224665 25 Left 1031224659 7:119020923-119020945 CCTATCAGCTCCCATTGCCACTG No data
Right 1031224665 7:119020971-119020993 GAGAATCCTGCAGTCCTTAGAGG No data
1031224660_1031224665 15 Left 1031224660 7:119020933-119020955 CCCATTGCCACTGCAAACACTTT No data
Right 1031224665 7:119020971-119020993 GAGAATCCTGCAGTCCTTAGAGG No data
1031224661_1031224665 14 Left 1031224661 7:119020934-119020956 CCATTGCCACTGCAAACACTTTC No data
Right 1031224665 7:119020971-119020993 GAGAATCCTGCAGTCCTTAGAGG No data
1031224658_1031224665 26 Left 1031224658 7:119020922-119020944 CCCTATCAGCTCCCATTGCCACT No data
Right 1031224665 7:119020971-119020993 GAGAATCCTGCAGTCCTTAGAGG No data
1031224662_1031224665 8 Left 1031224662 7:119020940-119020962 CCACTGCAAACACTTTCAGTTTG No data
Right 1031224665 7:119020971-119020993 GAGAATCCTGCAGTCCTTAGAGG No data
1031224657_1031224665 27 Left 1031224657 7:119020921-119020943 CCCCTATCAGCTCCCATTGCCAC No data
Right 1031224665 7:119020971-119020993 GAGAATCCTGCAGTCCTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031224665 Original CRISPR GAGAATCCTGCAGTCCTTAG AGG Intergenic
No off target data available for this crispr