ID: 1031228233

View in Genome Browser
Species Human (GRCh38)
Location 7:119069709-119069731
Sequence CAGTGTGCCCAGAGAGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031228233_1031228235 -5 Left 1031228233 7:119069709-119069731 CCAAATTCTCTCTGGGCACACTG No data
Right 1031228235 7:119069727-119069749 CACTGGAGCATTCCATATTATGG No data
1031228233_1031228238 14 Left 1031228233 7:119069709-119069731 CCAAATTCTCTCTGGGCACACTG No data
Right 1031228238 7:119069746-119069768 ATGGGACTCTAACATTAAGCAGG No data
1031228233_1031228236 -4 Left 1031228233 7:119069709-119069731 CCAAATTCTCTCTGGGCACACTG No data
Right 1031228236 7:119069728-119069750 ACTGGAGCATTCCATATTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031228233 Original CRISPR CAGTGTGCCCAGAGAGAATT TGG (reversed) Intergenic
No off target data available for this crispr