ID: 1031229646

View in Genome Browser
Species Human (GRCh38)
Location 7:119089200-119089222
Sequence CTAAAAACATAGATGAATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031229646_1031229648 5 Left 1031229646 7:119089200-119089222 CCCAGATTCATCTATGTTTTTAG No data
Right 1031229648 7:119089228-119089250 ATCAATTTTCTTCTTTTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031229646 Original CRISPR CTAAAAACATAGATGAATCT GGG (reversed) Intergenic
No off target data available for this crispr