ID: 1031230628

View in Genome Browser
Species Human (GRCh38)
Location 7:119100840-119100862
Sequence ATATTTCAGCCTATCACATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031230620_1031230628 -7 Left 1031230620 7:119100824-119100846 CCCTCCCCACAAGGCCATATTTC No data
Right 1031230628 7:119100840-119100862 ATATTTCAGCCTATCACATGGGG No data
1031230621_1031230628 -8 Left 1031230621 7:119100825-119100847 CCTCCCCACAAGGCCATATTTCA No data
Right 1031230628 7:119100840-119100862 ATATTTCAGCCTATCACATGGGG No data
1031230618_1031230628 3 Left 1031230618 7:119100814-119100836 CCAGGTGTTTCCCTCCCCACAAG No data
Right 1031230628 7:119100840-119100862 ATATTTCAGCCTATCACATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031230628 Original CRISPR ATATTTCAGCCTATCACATG GGG Intergenic
No off target data available for this crispr