ID: 1031235183

View in Genome Browser
Species Human (GRCh38)
Location 7:119166846-119166868
Sequence TTAATTATTTTGTAGTTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031235182_1031235183 7 Left 1031235182 7:119166816-119166838 CCTATGTGAGATTTTATTCATAT No data
Right 1031235183 7:119166846-119166868 TTAATTATTTTGTAGTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031235183 Original CRISPR TTAATTATTTTGTAGTTGTT TGG Intergenic
No off target data available for this crispr