ID: 1031240768

View in Genome Browser
Species Human (GRCh38)
Location 7:119236546-119236568
Sequence CTTTTTCCAGAGATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031240768_1031240771 10 Left 1031240768 7:119236546-119236568 CCTTCCTCCATCTCTGGAAAAAG No data
Right 1031240771 7:119236579-119236601 TCTTCTATCTTCTCTTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031240768 Original CRISPR CTTTTTCCAGAGATGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr